RNF34 (NM_001256858) Human Untagged Clone
CAT#: SC332490
RNF34 (untagged) - Homo sapiens ring finger protein 34, E3 ubiquitin protein ligase (RNF34), transcript variant 3
CNY 2,640.00
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CARP-1; CARP1; hRFI; RFI; RIF; RIFF |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC332490 representing NM_001256858.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAAGGGAGAGCTTATGGATGGAGACCAAACATCCAGATCTGGAGTGCCGGCACAGGTACAAAGTGAA ATCACTTCAGCAAACACAGAAGATGATGATGACGACGATGATGAGGATGATGATGATGAAGAAGAAAAC GCAGAGGATCGGAACCCCGGGCTCTCCAAGGAGAGAGTGAGAGCTTCACTGTCTGACTTGTCAAGCCTT GATGATGTGGAAGGAATGAGCGTGCGCCAGCTGAAGGAAATTCTGGCTCGGAATTTTGTCAACTATTCT GGCTGTTGTGAAAAATGGGAACTGGTAGAGAAAGTAAACCGGTTATACAAAGAGAATGAAGAAAACCAA AAGTCCTATGGCGAGCGGCTGCAGCTGCAGGATGAGGAAGACGACAGCCTGTGTCGCATCTGCATGGAT GCCGTCATCGACTGTGTCCTACTGGAGTGTGGGCACATGGTTACCTGCACCAAGTGCGGCAAGCGCATG AGTGAGTGTCCCATCTGCCGGCAGTATGTGGTGCGAGCCGTGCACGTGTTCAAGTCCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001256858 |
Insert Size | 543 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001256858.1 |
RefSeq Size | 1479 bp |
RefSeq ORF | 543 bp |
Locus ID | 80196 |
UniProt ID | Q969K3 |
Protein Families | Druggable Genome |
MW | 20.5 kDa |
Gene Summary | The protein encoded by this gene contains a RINF finger, a motif known to be involved in protein-protein and protein-DNA interactions. This protein interacts with DNAJA3/hTid-1, which is a DnaJ protein reported to function as a modulator of apoptosis. Overexpression of this gene in Hela cells was shown to confer the resistance to TNF-alpha induced apoptosis, suggesting an anti-apoptotic function of this protein. This protein can be cleaved by caspase-3 during the induction of apoptosis. This protein also targets p53 and phospho-p53 for degradation. Alternatively splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Feb 2012] Transcript Variant: This variant (3) has multiple differences in the 5' coding region which results in the use of an alternate translational start codon, compared to variant 1. The resulting isoform (3) has a shorter N-terminus, compared to variant 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC233377 | RNF34 (Myc-DDK tagged) - Homo sapiens ring finger protein 34, E3 ubiquitin protein ligase (RNF34), transcript variant 3 |
CNY 3,990.00 |
|
RG233377 | RNF34 (tGFP-tagged) - Homo sapiens ring finger protein 34, E3 ubiquitin protein ligase (RNF34), transcript variant 3 |
CNY 4,370.00 |