HTR2C (NM_001256760) Human Untagged Clone

CAT#: SC332468

HTR2C (untagged) - Homo sapiens 5-hydroxytryptamine (serotonin) receptor 2C, G protein-coupled (HTR2C), transcript variant 1



  "NM_001256760" in other vectors (2)

CN¥ 4,370.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-HTR2C Antibody
    • 100 ug

CN¥ 4,537.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms 5-HT1C; 5-HT2C; 5-HTR2C; 5HTR2C; HTR1C
Vector pCMV6-Entry
Sequence Data
>SC332468 representing NM_001256760.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGTGAACCTGAGGAATGCGGTGCATTCATTCCTTGTGCACCTAATTGGCCTATTGGTTTGGCAATGT
GATATTTCTGTGAGCCCAGTAGCAGCTATAGTAACTGACATTTTCAATACCTCCGATGGTGGACGCTTC
AAATTCCCAGACGGGGTACAAAACTGGCCAGCACTTTCAATCGTCATCATAATAATCATGACAATAGGT
GGCAACATCCTTGTGATCATGGCAGTAAGCATGGAAAAGAAACTGCACAATGCCACCAATTACTTCTTA
ATGTCCCTAGCCATTGCTGATATGCTAGTGGGACTACTTGTCATGCCCCTGTCTCTCCTGGCAATCCTT
TATGATTATGTCTGGCCACTACCTAGATATTTGTGCCCCGTCTGGATTTCTTTAGATGTTTTATTTTCA
ACAGCGTCCATCATGCACCTCTGCGCTATATCGCTGGATCGGTATGTAGCAATACGTAATCCTATTGAG
CATAGCCGTTTCAATTCGCGGACTAAGGCCATCATGAAGATTGCTATTGTTTGGGCAATTTCTATAGGT
GTATCAGTTCCTATCCCTGTGATTGGACTGAGGGACGAAGAAAAGGTGTTCGTGAACAACACGACGTGC
GTGCTCAACGACCCAAATTTCGTTCTTATTGGGTCCTTCGTAGCTTTCTTCATACCGCTGACGATTATG
GTGATTACGTATTGCCTGACCATCTACGTTCTGCGCCGACAAGCTTTGATGTTACTGCACGGCCACACC
GAGGAACCGCCTGGACTAAGTCTGGATTTCCTGAAGTGCTGCAAGAGGAATACGGCCGAGGAAGAGAAC
TCTGCAAACCCTAACCAAGACCAGAACGCACGCCGAAGAAAGAAGAAGGAGAGACGTCCTAGGGGCACC
ATGCAGGCTATCAACAATGAAAGAAAAGCTTCGAAAGTCCTTGGGATTGTTTTCTTTGTGTTTCTGATC
ATGTGGTGCCCATTTTTCATTACCAATATTCTGTCTGTTCTTTGTGAGAAGTCCTGTAACCAAAAGCTC
ATGGAAAAGCTTCTGAATGTGTTTGTTTGGATTGGCTATGTTTGTTCAGGAATCAATCCTCTGGTGTAT
ACTCTGTTCAACAAAATTTACCGAAGGGCATTCTCCAACTATTTGCGTTGCAATTATAAGGTAGAGAAA
AAGCCTCCTGTCAGGCAGATTCCAAGAGTTGCCGCCACTGCTTTGTCTGGGAGGGAGCTTAATGTTAAC
ATTTATCGGCATACCAATGAACCGGTGATCGAGAAAGCCAGTGACAATGAGCCCGGTATAGAGATGCAA
GTTGAGAATTTAGAGTTACCAGTAAATCCCTCCAGTGTGGTTAGCGAAAGGATTAGCAGTGTGTGA

Restriction Sites SgfI-MluI     
ACCN NM_001256760
Insert Size 1377 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001256760.1
RefSeq Size 4865 bp
RefSeq ORF 1377 bp
Locus ID 3358
UniProt ID P28335
Protein Families Druggable Genome, GPCR, Transmembrane
Protein Pathways Calcium signaling pathway, Gap junction, Neuroactive ligand-receptor interaction
MW 51.8 kDa
Gene Summary This gene encodes a seven-transmembrane G-protein-coupled receptor. The encoded protein responds to signaling through the neurotransmitter serotonin. The mRNA of this gene is subject to multiple RNA editing events, where adenosine residues encoded by the genome are converted to inosines. RNA editing is predicted to alter the structure of the second intracellular loop, thereby generating alternate protein forms with decreased ability to interact with G proteins. Abnormalities in RNA editing of this gene have been detected in victims of suicide that suffer from depression. In addition, naturally-occuring variation in the promoter and 5' non-coding and coding regions of this gene may show statistically-significant association with mental illness and behavioral disorders. Alternative splicing results in multiple different transcript variants. [provided by RefSeq, Jan 2015]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (a). Variants 1 and 2 both encode the same isoform (a). This variant may undergo RNA editing.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...