LHX8 (NM_001256114) Human Untagged Clone

CAT#: SC332299

LHX8 (untagged) - Homo sapiens LIM homeobox 8 (LHX8), transcript variant 2



  "NM_001256114" in other vectors (2)

CNY 3,330.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-Lhx8 Antibody
    • 50 ug

CNY 4,628.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms LHX7
Vector pCMV6-Entry
Sequence Data
>SC332299 representing NM_001256114.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTCAGAGGAGTGCGGGCGGACTACAGCCCTGGCGGCCGGGAGGACTCGCAAAGGCGCCGGGGAAGAG
GGACTGGTGAGCCCCGAGGGAGCGGGGGACGAGGACTCGTGCTCCTCCTCGGCCCCGCTGTCCCCGTCG
TCCTCGCCCCGGTCCATGGCCTCGGGCTCCGGCTGCCCTCCTGGCAAGTGTGTGTGCAACAGTTGCGGC
CTGGAGATCGTGGACAAATACCTTCTCAAGGTGAATGACCTATGCTGGCATGTCCGGTGTCTCTCCTGC
AGTGTTTGCAGAACCTCCCTAGGAAGGCACACCAGCTGTTATATTAAAGACAAAGACATTTTCTGCAAA
CTTGATTATTTCAGAAGGTATGGAACTCGCTGCTCTCGATGTGGGAGACACATCCATTCTACTGACTGG
GTCCGGAGAGCCAAGGGGAATGTCTATCACTTGGCATGCTTTGCCTGCTTTTCCTGCAAAAGGCAACTT
TCCACAGGAGAGGAGTTTGCTTTGGTGGAAGAGAAAGTCCTCTGCAGAGTACATTATGACTGCATGCTG
GATAATTTAAAAAGAGAAGTAGAAAATGGGAATGGGATTAGTGTGGAAGGTGCCCTCCTCACAGAGCAA
GATGTTAACCATCCAAAACCAGCAAAAAGAGCTCGGACCAGCTTTACAGCAGATCAGCTTCAGGTTATG
CAAGCACAATTTGCTCAGGACAACAACCCAGATGCACAGACACTCCAGAAATTGGCAGAAAGGACAGGC
TTGAGCAGACGTGTGATACAGGTGTGGTTTCAGAATTGTAGAGCACGCCACAAGAAACACGTCAGTCCT
AATCACTCATCCTCCACCCCAGTCACAGCAGTCCCACCCTCCAGGCTGTCTCCACCCATGTTAGAAGAA
ATGGCTTATTCTGCCTACGTGCCCCAAGATGGAACGATGTTAACTGCGCTGCATAGTTATATGGATGCT
CATTCACCAACAACTCTTGGACTCCAGCCCTTGTTACCCCATTCAATGACACAACTGCCAATAAGTCAT
ACCTAA

Restriction Sites SgfI-MluI     
ACCN NM_001256114
Insert Size 1041 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001256114.1
RefSeq Size 1784 bp
RefSeq ORF 1041 bp
Locus ID 431707
UniProt ID Q68G74
MW 38.2 kDa
Gene Summary The protein encoded by this gene is a member of the LIM homeobox family of proteins, which are involved in patterning and differentiation of various tissue types. These proteins contain two tandemly repeated cysteine-rich double-zinc finger motifs known as LIM domains, in addition to a DNA-binding homeodomain. This family member is a transcription factor that plays a role in tooth morphogenesis. It is also involved in oogenesis and in neuronal differentiation. This gene is a candidate gene for cleft palate, and it is also associated with odontoma formation. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2012]
Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and uses a downstream translational start codon, compared to variant 1. The encoded isoform (2) is shorter at the N-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...