CEBP gamma (CEBPG) (NM_001252296) Human Untagged Clone
CAT#: SC332185
CEBPG (untagged) - Homo sapiens CCAAT/enhancer binding protein (C/EBP), gamma (CEBPG), transcript variant 2
CNY 2,950.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | GPE1BP; IG/EBP-1 |
Vector | pCMV6-Entry |
Sequence Data |
>SC332185 representing NM_001252296.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGAGCAAGATATCGCAGCAAAACAGCACTCCAGGGGTGAACGGAATTAGTGTTATCCATACCCAGGCA CATGCCAGCGGCTTACAGCAGGTTCCTCAGCTGGTGCCTGCTGGCCCTGGGGGAGGAGGCAAAGCTGTG GCTCCCAGCAAGCAGAGCAAAAAGAGTTCGCCCATGGATCGAAACAGTGACGAGTATCGGCAACGCCGA GAGAGGAACAACATGGCTGTGAAAAAGAGCCGGTTGAAAAGCAAGCAGAAAGCACAAGACACACTGCAG AGAGTCAATCAGCTCAAAGAAGAGAATGAACGGTTGGAAGCAAAAATCAAATTGCTGACCAAGGAATTA AGTGTACTCAAAGATTTGTTTCTTGAGCATGCACACAACCTTGCAGACAACGTACAGTCCATTAGCACT GAAAATACGACAGCAGATGGCGACAATGCAGGACAGTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001252296 |
Insert Size | 453 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001252296.1 |
RefSeq Size | 3647 bp |
RefSeq ORF | 453 bp |
Locus ID | 1054 |
UniProt ID | P53567 |
Protein Families | Druggable Genome, Transcription Factors |
MW | 16.4 kDa |
Gene Summary | The C/EBP family of transcription factors regulates viral and cellular CCAAT/enhancer element-mediated transcription. C/EBP proteins contain the bZIP region, which is characterized by two motifs in the C-terminal half of the protein: a basic region involved in DNA binding and a leucine zipper motif involved in dimerization. The C/EBP family consist of several related proteins, C/EBP alpha, C/EBP beta, C/EBP gamma, and C/EBP delta, that form homodimers and that form heterodimers with each other. CCAAT/enhancer binding protein gamma may cooperate with Fos to bind PRE-I enhancer elements. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Nov 2011] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 both encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC233310 | CEBPG (Myc-DDK tagged) - Homo sapiens CCAAT/enhancer binding protein (C/EBP), gamma (CEBPG), transcript variant 2 |
CNY 1,200.00 |
|
RG233310 | CEBPG (tGFP-tagged) - Homo sapiens CCAAT/enhancer binding protein (C/EBP), gamma (CEBPG), transcript variant 2 |
CNY 4,370.00 |
其它CEBP gamma产品