PIK3R5 (NM_001251852) Human Untagged Clone

CAT#: SC332137

PIK3R5 (untagged) - Homo sapiens phosphoinositide-3-kinase, regulatory subunit 5 (PIK3R5), transcript variant 4



  "NM_001251852" in other vectors (2)

CN¥ 4,750.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
PIK3R5 mouse monoclonal antibody, clone OTI4G9 (formerly 4G9)
    • 100 ul

CN¥ 1,999.00
CN¥ 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms F730038I15Rik; FOAP-2; p101; P101-PI3K
Vector pCMV6-Entry
Sequence Data
>SC332137 representing NM_001251852.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGACAGCGGCTACGTGGAGGACAGCGAGGAGAGCTCCTCCGAGTGGCCTTGGAGGCGTGGCAGCCAG
GAACGCCGAGGCCACCGCAGGCCTGGGCAGAAGTTCATCAGGATCTATAAACTCTTCAAGAGCACCAGC
CAGCTGGTACTGCGGAGGGACTCTCGGAGCCTGGAGGGCAGCTCGGACACGGCCCTGCCCCTGAGGCGG
GCAGGGAGCCTCTGCAGCCCCCTGGACGAACCAGTATCACCCCCTTCCCGGGCCCAGCGCTCCCGCTCC
CTGCCCCAGCCCAAACTCGGTACCCAGCTGCCCAGCTGGCTTCTGGCCCCTGCTTCACGCCCCCAGCGC
CGCCGCCCCTTCCTGAGTGGAGATGAGGATCCCAAGGCTTCCACGCTACGTGTTGTGGTCTTTGGCTCC
GATCGGATTTCAGGGAAGGTGGCTCGGGCGTACAGCAACCTTCGGCGGCTGGAGAACAATCGCCCACTC
CTCACACGGTTCTTCAAACTTCAGTTCTTCTACGTGCCTGTGAAGCGAAGTCATGGGACCAGCCCTGGT
GCCTGTCCACCCCCTCGGAGCCAGACGCCCTCACCCCCGACAGACTCCCCTAGGCACGCCAGCCCTGGA
GAGCTGGGCACCACCCCATGGGAGGAGAGCACCAATGACATCTCCCACTACCTCGGCATGCTGGACCCC
TGGTATGAGCGCAATGTACTGGGCCTCATGCACCTGCCCCCTGAAGTCCTGTGCCAGCAGTCCCTGAAG
GCTGAAGCCCAGGCCCTGGAGGGCTCCCCAACCCAGCTGCCCATCCTGGCTGACATGCTACTCTACTAC
TGCCGCTTTGCCGCCAGACCGGTGCTGCTGCAAGTCTATCAGACCGAGCTGACCTTCATCACTGGGGAG
AAGACGACAGAGATCTTCATCCACTCCTTGGAGCTGGGTCACTCCGCTGCCACACGTGCCATCAAGGCG
TCAGGTCCTGGCAGCAAGCGGCTGGGCATCGATGGCGACCGGGAGGCTGTTCCTCTAACACTACAGATT
ATTTACAGCAAGGGGGCCATCAGTGGACGAAGTCGCTGGAGCAACCTGGAGAAGGTCTGTACCTCCGTG
AACCTCAACAAGGCCTGCCGGAAGCAGGAGGAGCTGGATTCCAGCATGGAGGCCCTGACGCTAAACCTG
ACAGAAGTGGTGAAAAGGCAGAACTCCAAATCCAAGAAGGGCTTTAACCAGATTAGCACATCGCAGATC
AAAGTGGACAAGGTGCAGATCATCGGCTCCAACAGCTGCCCCTTTGCTGTGTGCCTGGACCAGGATGAG
AGAAAGATCCTGCAGAGTGTAGTCAGATGTGAGGTCTCACCGTGCTACAAGCCAGAGAAGAGCGACCTC
TCCTCACCACCCCAGACGCCTCCTGACCTGCCGGCCCAGGCCGCACCTGATCTCTGCTCCCTTCTCTGC
CTGCCCATCATGACTTTCAGTGGAGCTCTGCCCTAG

Restriction Sites SgfI-MluI     
ACCN NM_001251852
Insert Size 1485 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001251852.1
RefSeq Size 4427 bp
RefSeq ORF 1485 bp
Locus ID 23533
UniProt ID Q8WYR1
Protein Families Druggable Genome
Protein Pathways Acute myeloid leukemia, Apoptosis, B cell receptor signaling pathway, Chemokine signaling pathway, Chronic myeloid leukemia, Colorectal cancer, Endometrial cancer, ErbB signaling pathway, Fc epsilon RI signaling pathway, Fc gamma R-mediated phagocytosis, Focal adhesion, Glioma, Insulin signaling pathway, Jak-STAT signaling pathway, Leukocyte transendothelial migration, Melanoma, mTOR signaling pathway, Natural killer cell mediated cytotoxicity, Neurotrophin signaling pathway, Non-small cell lung cancer, Pancreatic cancer, Pathways in cancer, Phosphatidylinositol signaling system, Progesterone-mediated oocyte maturation, Prostate cancer, Regulation of actin cytoskeleton, Renal cell carcinoma, Small cell lung cancer, T cell receptor signaling pathway, Toll-like receptor signaling pathway, Type II diabetes mellitus, VEGF signaling pathway
MW 54.9 kDa
Gene Summary Phosphatidylinositol 3-kinases (PI3Ks) phosphorylate the inositol ring of phosphatidylinositol at the 3-prime position, and play important roles in cell growth, proliferation, differentiation, motility, survival and intracellular trafficking. The PI3Ks are divided into three classes: I, II and III, and only the class I PI3Ks are involved in oncogenesis. This gene encodes the 101 kD regulatory subunit of the class I PI3K gamma complex, which is a dimeric enzyme, consisting of a 110 kD catalytic subunit gamma and a regulatory subunit of either 55, 87 or 101 kD. This protein recruits the catalytic subunit from the cytosol to the plasma membrane through high-affinity interaction with G-beta-gamma proteins. Multiple alternatively spliced transcript variants encoding two distinct isoforms have been found. [provided by RefSeq, Oct 2011]
Transcript Variant: This variant (4) lacks an exon in the 5' region, which results in a downstream AUG start codon, compared to variant 1. The resulting isoform (2) is shorter at the N-terminus than isoform 1. Variants 3-6 encode the same isoform 2.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...