TIS11B (ZFP36L1) (NM_001244698) Human Untagged Clone

CAT#: SC332082

ZFP36L1 (untagged) - Homo sapiens ZFP36 ring finger protein-like 1 (ZFP36L1), transcript variant 2



  "NM_001244698" in other vectors (2)

CNY 3,330.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
ZFP36L1 mouse monoclonal antibody,clone OTI4F8
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms Berg36; BRF1; cMG1; ERF-1; ERF1; RNF162B; TIS11B
Vector pCMV6-Entry
Sequence Data
>SC332082 representing NM_001244698.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGACCACCACCCTCGTGTCTGCCACCATCTTCGACTTGAGCGAAGTTTTATGCAAGGGTAACAAGATG
CTCAACTATAGTGCTCCCAGTGCAGGGGGTTGCCTGCTGGACAGAAAGGCAGTGGGCACCCCTGCTGGT
GGGGGCTTCCCTCGGAGGCACTCAGTCACCCTGCCCAGCTCCAAGTTCCACCAGAACCAGCTCCTCAGC
AGCCTCAAGGGTGAGCCAGCCCCCGCTCTGAGCTCGCGAGACAGCCGCTTCCGAGACCGCTCCTTCTCG
GAAGGGGGCGAGCGGCTGCTGCCCACCCAGAAGCAGCCCGGGGGCGGCCAGGTCAACTCCAGCCGCTAC
AAGACGGAGCTGTGCCGCCCCTTTGAGGAAAACGGTGCCTGTAAGTACGGGGACAAGTGCCAGTTCGCA
CACGGCATCCACGAGCTCCGCAGCCTGACCCGCCACCCCAAGTACAAGACGGAGCTGTGCCGCACCTTC
CACACCATCGGCTTTTGCCCCTACGGGCCCCGCTGCCACTTCATCCACAACGCTGAAGAGCGCCGTGCC
CTGGCCGGGGCCCGGGACCTCTCCGCTGACCGTCCCCGCCTCCAGCATAGCTTTAGCTTTGCTGGGTTT
CCCAGTGCCGCTGCCACCGCCGCTGCCACCGGGCTGCTGGACAGCCCCACGTCCATCACCCCACCCCCT
ATTCTGAGCGCCGATGACCTCCTGGGCTCACCTACCCTGCCCGATGGCACCAATAACCCTTTTGCCTTC
TCCAGCCAGGAGCTGGCAAGCCTCTTTGCCCCTAGCATGGGGCTGCCCGGGGGTGGCTCCCCGACCACC
TTCCTCTTCCGGCCCATGTCCGAGTCCCCTCACATGTTTGACTCTCCCCCCAGCCCTCAGGATTCTCTC
TCGGACCAGGAGGGCTACCTGAGCAGCTCCAGCAGCAGCCACAGTGGCTCAGACTCCCCGACCTTGGAC
AACTCAAGACGCCTGCCCATCTTCAGCAGACTTTCCATCTCAGATGACTAA

Restriction Sites SgfI-MluI     
ACCN NM_001244698
Insert Size 1017 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001244698.1
RefSeq Size 3170 bp
RefSeq ORF 1017 bp
Locus ID 677
UniProt ID Q07352
Protein Families Transcription Factors
MW 36.3 kDa
Gene Summary This gene is a member of the TIS11 family of early response genes, which are induced by various agonists such as the phorbol ester TPA and the polypeptide mitogen EGF. This gene is well conserved across species and has a promoter that contains motifs seen in other early-response genes. The encoded protein contains a distinguishing putative zinc finger domain with a repeating cys-his motif. This putative nuclear transcription factor most likely functions in regulating the response to growth factors. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
Transcript Variant: This variant (2) is alternatively spliced at the 3' end, and has a shorter 3' UTR compared to variant 1. Variants 1 and 2 encode the same isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...