HYI (NM_001243526) Human Untagged Clone

CAT#: SC332007

HYI (untagged) - Homo sapiens hydroxypyruvate isomerase (putative) (HYI), transcript variant 4



  "NM_001243526" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


HYI rabbit polyclonal antibody
    • 25 ul

CNY 800.00
CNY 1,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HT036
Vector pCMV6-Entry
Sequence Data
>SC332007 representing NM_001243526.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCGCCGCTGCGCTTCTCCGCCAATCTGTCCTGGCTATTCCCCGAGCTCTCCGGCCTCCCCGCGCGG
GTGCGGGCCGCGGGCAGCTCGGGCTTCGAGGCCGTCGAGGTGGCCTGGCCGTACGCGGAGACGCCTGAG
GCGCTGGCGCGCGCCGCGCGAGAAGCGGGGCTGCGGCTTGTACTGATCAACACGCCCCCGGGAGACCAA
GAGAAGGGGGAAATGGGGCTGGGGGCCGTCCCCGGGAGACAGGCGGCCTTCCGAGAGGGACTGGAGCAG
GCCGTGCGGAGTGGGCATTGCTTGATGGGCAGGAAGTTGAGTGTTCCTTGCAAGGGTGCTGTGGCAAGA
GGAGGCCTGGTGTATTTGGCAGCGTTCCTGAGGCTGGACATGATCCACCTGATGGCTGGCCGAGTACCC
CAGGGAGCTGATCGAATAGCAGTCAAGGCTGAGATGGAGGCCGTTTTTCTGGAGAACCTGAGGCATGCA
GCTGGGGTTTTGGCTCAGGAGGACCTCGTGGGACTGCTGGAGCCCATCAACACCCGCATCACTGACCCC
CAGTACTTCCTGGACACGCCCCAGCAGGCGGCAGCCATCTTACAGAAGGTAGGAAGACCCAACCTCCAA
TTACAAATGGACATATTCCACTGGCAGATCATGGATGGGAACCTGACAGGAAACATCCGGGAGTTCCTG
CCCATTGTTGGGCATGTGCAGGTGGCACAGGTCCCAGGCCGAGGGGAGCCCAGCAGCCCCGGAGAGCTG
AATTTCCCCTATCTGTTTCAACTGCTGGAAGATGAAGGCTACAAAGGCTTCGTGGGCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001243526
Insert Size 819 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001243526.1
RefSeq Size 1326 bp
RefSeq ORF 819 bp
Locus ID 81888
UniProt ID Q5T013
Protein Pathways Glyoxylate and dicarboxylate metabolism, Metabolic pathways
MW 29.5 kDa
Gene Summary This gene encodes a putative hydroxypyruvate isomerase, which likely catalyzes the conversion of hydroxypyruvate to 2-hydroxy-3-oxopropanoate, and may be involved in carbohydrate transport and metabolism. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Transcript Variant: This variant (4) contains an alternate splice junction in the 3' end compared to variant 5. The resulting isoform (4) is shorter at the C-terminus compared to isoform 5.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...