IKB beta (NFKBIB) (NM_001243116) Human Untagged Clone

CAT#: SC331948

NFKBIB (untagged) - Homo sapiens nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta (NFKBIB), transcript variant 2



  "NM_001243116" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit anti-NFKBIB Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms IKBB; TRIP9
Vector pCMV6-Entry
Sequence Data
>SC331948 representing NM_001243116.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGACCTGCAGAATGACCTAGGCCAGACAGCCCTGCACCTGGCAGCCATCCTGGGGGAGACATCCACG
GTGGAGAAGCTGTACGCAGCAGGCGCCGGGCTGTGTGTGGCGGAGCGTAGGGGCCACACGGCGCTGCAC
CTGGCCTGCCGTGTGGGGGCACACGCCTGTGCCCGTGCCCTGCTTCAGCCCCGCCCCCGGCGCCCCAGG
GAAGCCCCCGACACCTACCTCGCTCAGGGCCCTGACCGTACTCCCGACACCAACCATACCCCTGTCGCC
TTGTACCCCGATTCCGACTTGGAGAAGGAAGAAGAGGAGAGTGAGGAGGACTGGAAGCTGCAGCTGGAG
GCTGAAAACTACGAGGGCCACACCCCACTCCACGTGGCCGTTATCCACAAAGATGTGGAGATGGTCCGG
CTGCTCCGAGATGCTGGAGCTGACCTTGACAAACCGGAGCCCACGTGCGGCCGGAGCCCCCTTCATTTG
GCAGTGGAGGCCCAGGCAGCCGATGTGCTGGAGCTTCTCCTGAGGGCAGGCGCGAACCCTGCTGCCCGC
ATGTACGGTGGCCGCACCCCACTCGGCAGTGCCATGCTCCGGCCCAACCCCATCCTCGCCCGCCTCCTC
CGTGCACACGGAGCCCCTGAGCCCGAGGGCGAGGACGAGAAATCCGGCCCCTGCAGCAGCAGTAGCGAC
AGCGACAGCGGAGACGAGGGCGATGAATACGACGACATTGTGGTTCACAGCAGCCGCAGCCAAACCCGG
CTGCCTCCCACCCCAGCCTCAAAACCTCTTCCTGACGACCCCCGCCCCGTGTGA

Restriction Sites SgfI-MluI     
ACCN NM_001243116
Insert Size 813 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001243116.1
RefSeq Size 1001 bp
RefSeq ORF 813 bp
Locus ID 4793
UniProt ID Q15653
Protein Families Stem cell - Pluripotency, Transcription Factors
Protein Pathways Adipocytokine signaling pathway, B cell receptor signaling pathway, Chemokine signaling pathway, Cytosolic DNA-sensing pathway, Neurotrophin signaling pathway, NOD-like receptor signaling pathway, RIG-I-like receptor signaling pathway, T cell receptor signaling pathway
MW 29.1 kDa
Gene Summary The protein encoded by this gene belongs to the NF-kappa-B inhibitor family, which inhibit NF-kappa-B by complexing with, and trapping it in the cytoplasm. Phosphorylation of serine residues on these proteins by kinases marks them for destruction via the ubiquitination pathway, thereby allowing activation of the NF-kappa-B, which translocates to the nucleus to function as a transcription factor. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Jul 2011]
Transcript Variant: This variant (2) contains an alternate 5' terminal exon compared to variant 1. This results in translation initiation from an in-frame downstream AUG, and a shorter isoform (2) compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...