E2F3 (NM_001243076) Human Untagged Clone

CAT#: SC331943

E2F3 (untagged) - Homo sapiens E2F transcription factor 3 (E2F3), transcript variant 2



  "NM_001243076" in other vectors (2)

CNY 4,024.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-E2F3 Antibody
    • 100 ug

CNY 5,808.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms E2F-3
Vector pCMV6-Entry
Sequence Data
>SC331943 representing NM_001243076.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCCCTTACAGCAGCAGGCAAAGCGAAGGCTGGAGCTAGGAGAAAGCGGTCATCAGTACCTCTCAGAT
GGTTTAAAAACCCCCAAGGGCAAAGGAAGAGCTGCACTACGAAGTCCAGATAGTCCAAAAAAAAAAACG
CGGTATGATACGTCTCTTGGTCTGCTCACCAAGAAGTTCATTCAGCTCCTGAGCCAGTCACCCGATGGG
GTATTGGATTTGAACAAGGCAGCAGAAGTGCTAAAAGTGCAAAAGAGAAGGATTTATGATATCACCAAC
GTTCTGGAAGGCATCCACCTCATTAAGAAGAAGTCTAAAAACAACGTCCAATGGATGGGCTGCAGTCTG
TCTGAGGATGGGGGCATGCTGGCCCAGTGTCAAGGCCTGTCAAAAGAAGTGACCGAGCTCAGTCAGGAA
GAGAAGAAATTAGATGAACTGATCCAAAGCTGCACCCTGGACCTCAAACTGTTAACCGAGGATTCAGAG
AATCAAAGGTTAGCTTATGTTACATATCAAGATATTCGAAAAATTAGTGGCCTTAAAGACCAAACTGTT
ATAGTTGTGAAAGCCCCTCCAGAAACAAGACTTGAAGTGCCTGACTCAATAGAGAGCCTACAAATACAT
TTGGCAAGTACCCAAGGGCCCATTGAGGTTTACTTATGTCCAGAAGAGACTGAAACACACAGTCCAATG
AAAACAAACAACCAAGACCACAATGGGAATATCCCTAAACCCGCTTCCAAAGACTTGGCTTCAACCAAC
TCAGGACATAGCGATTGCTCAGTTTCTATGGGAAACCTTTCTCCTCTGGCCTCCCCAGCCAACCTCTTA
CAGCAGACTGAGGACCAAATTCCTTCCAACCTAGAAGGACCGTTTGTGAACTTACTGCCTCCCCTGCTG
CAAGAGGACTATCTCCTGAGCCTCGGGGAGGAGGAAGGCATCAGCGATCTCTTCGATGCTTACGATTTG
GAAAAGCTCCCACTGGTGGAAGACTTCATGTGTAGTTGA

Restriction Sites SgfI-MluI     
ACCN NM_001243076
Insert Size 1005 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001243076.2
RefSeq Size 4443 bp
RefSeq ORF 1005 bp
Locus ID 1871
UniProt ID O00716
Protein Families Druggable Genome, Transcription Factors
Protein Pathways Bladder cancer, Cell cycle, Chronic myeloid leukemia, Glioma, Melanoma, Non-small cell lung cancer, Pancreatic cancer, Pathways in cancer, Prostate cancer, Small cell lung cancer
MW 37 kDa
Gene Summary This gene encodes a member of a small family of transcription factors that function through binding of DP interaction partner proteins. The encoded protein recognizes a specific sequence motif in DNA and interacts directly with the retinoblastoma protein (pRB) to regulate the expression of genes involved in the cell cycle. Altered copy number and activity of this gene have been observed in a number of human cancers. There are pseudogenes for this gene on chromosomes 2 and 17. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
Transcript Variant: This variant (2, also known as b) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. The resulting isoform is shorter and has a distinct N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...