ODAPH (NM_001206981) Human Untagged Clone

CAT#: SC331726

C4orf26 (untagged) - Homo sapiens chromosome 4 open reading frame 26 (C4orf26), transcript variant 1



  "NM_001206981" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-C4orf26 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AI2A4; C4orf26
Vector pCMV6-Entry
Sequence Data
>SC331726 representing NM_001206981.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCTCGCAGACACTGCTTCTCCTACTGGTTACTGGTATGCTGGTTGGTGGTAACTGTGGCAGAAGCA
CTGTCCACTTTCTATCTCCAGCAGCATATTAATTTGCACATGGACAAGAAGAGGTATTTACGCCTCCTG
GAGATTCACAAAATAATGCGGACGCTACCGACTGCCAGATCTTTACACTCACCCCTCCACCTGCCCCGA
GGAGTCCGGTCACAAGGGCCCAGCCCATCACAAAGACACCCAGGTGTCCCTTCCATTTTTTTCCACGAA
GGCCCAGAATCCATTTTAGGTTTCCAAACAGACCTTTCGTCCCTTCAAGGTGTAACCACCGTTTTCCAT
TCCAGCCATTTTATTGGCCACACCGTTACCTTACTTATAGGTATTTCCCCAGAAGAAGACTCCAGAGAG
GAAGCTCATCTGAGGAAAGCTGAGAGGGAAGAGAAACCCAAACATACTGAAGCAAAAAAAAGCCTATCC
TTCAGAAAAAAGCAACAAAAAGATTTCTGTTTTATCTTTCGAAACTAA

Restriction Sites SgfI-MluI     
ACCN NM_001206981
Insert Size 531 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001206981.1
RefSeq Size 1926 bp
RefSeq ORF 531 bp
Locus ID 152816
UniProt ID Q17RF5
MW 20.4 kDa
Gene Summary Dental enamel forms the outer cap of teeth and is the hardest substance found in vertebrates. This gene is thought to encode an extracellular matrix acidic phosphoprotein that has a function in enamel mineralization during amelogenesis. Mutations in this gene are associated with recessive hypomineralized amelogenesis imperfecta. [provided by RefSeq, Oct 2012]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...