CACNB3 (NM_001206915) Human Untagged Clone

CAT#: SC331702

CACNB3 (untagged) - Homo sapiens calcium channel, voltage-dependent, beta 3 subunit (CACNB3), transcript variant 2



  "NM_001206915" in other vectors (2)

CN¥ 4,280.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00


CACNB3 rabbit polyclonal antibody
    • 100 ul

CN¥ 1,999.00
CN¥ 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CAB3; CACNLB3
Vector pCMV6-Entry
Sequence Data
>SC331702 representing NM_001206915.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTATGACGACTCCTACGTGCCCGGGTTTGAGGACTCGGAGGCGGGTTCAGCCGACTCCTACACCAGC
CGCCCATCTCTGGACTCAGACGTCTCCCTGGAGGAGGACCGGGAGAGTGCCCGGCGTGAAGTAGAGAGC
CAGGCTCAGCAGCAGCTCGAAAGGGCCAAGAAGTACAGCAATGACTGGTGGATCGGGCGGCTAGTGAAA
GAGGGCGGGGACATCGCCTTCATCCCCAGCCCCCAGCGCCTGGAGAGCATCCGGCTCAAACAGGAGCAG
AAGGCCAGGAGATCTGGGAACCCTTCCAGCCTGAGTGACATTGGCAACCGACGCTCCCCTCCGCCATCT
CTAGCCAAGCAGAAGCAAAAGCAGGCGGAACATGTTCCCCCATATGACGTGGTGCCCTCCATGCGGCCT
GTGGTGCTGGTGGGACCCTCTCTGAAAGGTTATGAGGTCACAGACATGATGCAGAAGGCTCTCTTCGAC
TTCCTCAAACACAGATTTGATGGCAGGATCTCCATCACCCGAGTCACAGCCGACCTCTCCCTGGCAAAG
CGATCTGTGCTCAACAATCCGGGCAAGAGGACCATCATTGAGCGCTCCTCTGCCCGCTCCAGCATTGCG
GAAGTGCAGAGTGAGATCGAGCGCATATTTGAGCTGGCCAAATCCCTGCAGCTAGTAGTGTTGGACGCT
GACACCATCAACCACCCAGCACAGCTGGCCAAGACCTCGCTGGCCCCCATCATCGTCTTTGTCAAAGTG
TCCTCACCAAAGGTACTCCAGCGTCTCATTCGCTCCCGGGGGAAGTCACAGATGAAGCACCTGACCGTA
CAGATGATGGCATATGATAAGCTGGTTCAGTGCCCACCGGAGTCATTTGATGTGATTCTGGATGAGAAC
CAGCTGGAGGATGCCTGTGAGCACCTGGCTGAGTACCTGGAGGTTTACTGGCGGGCCACGCACCACCCA
GCCCCTGGCCCCGGACTTCTGGGTCCTCCCAGTGCCATCCCCGGACTTCAGAACCAGCAGCTGCTGGGG
GAGCGTGGCGAGGAGCACTCCCCCCTTGAGCGGGACAGCTTGATGCCCTCTGATGAGGCCAGCGAGAGC
TCCCGCCAAGCCTGGACAGGATCTTCACAGCGTAGCTCCCGCCACCTGGAGGAGGACTATGCAGATGCC
TACCAGGACCTGTACCAGCCTCACCGCCAACACACCTCGGGGCTGCCTAGTGCTAACGGGCATGACCCC
CAAGACCGGCTTCTAGCCCAGGACTCAGAGCACAACCACAGTGACCGGAACTGGCAGCGCAACCGGCCT
TGGCCCAAGGATAGCTACTGA

Restriction Sites SgfI-MluI     
ACCN NM_001206915
Insert Size 1332 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001206915.1
RefSeq Size 2835 bp
RefSeq ORF 1332 bp
Locus ID 784
UniProt ID P54284
Protein Families Druggable Genome, Ion Channels: Other
Protein Pathways Arrhythmogenic right ventricular cardiomyopathy (ARVC), Cardiac muscle contraction, Dilated cardiomyopathy, Hypertrophic cardiomyopathy (HCM), MAPK signaling pathway
MW 50 kDa
Gene Summary This gene encodes a regulatory beta subunit of the voltage-dependent calcium channel. Beta subunits are composed of five domains, which contribute to the regulation of surface expression and gating of calcium channels and may also play a role in the regulation of transcription factors and calcium transport. [provided by RefSeq, Oct 2011]
Transcript Variant: This variant (2) lacks an exon in the 5' coding region, but maintains the reading frame, compared to variant 1. The encoded isoform (2) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...