MEK5 (MAP2K5) (NM_001206804) Human Untagged Clone

CAT#: SC331687

MAP2K5 (untagged) - Homo sapiens mitogen-activated protein kinase kinase 5 (MAP2K5), transcript variant 3



  "NM_001206804" in other vectors (2)

CN¥ 3,900.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
MEK5 Rabbit polyclonal Antibody
    • 100 ul

CN¥ 1,999.00
CN¥ 3,280.00

热销推荐


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HsT17454; MAPKK5; MEK5; PRKMK5
Vector pCMV6-Entry
Sequence Data
>SC331687 representing NM_001206804.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGATGGAGGGTCACTTTCCCCAGAGCGATGTGATAGGCCAGGTTCTGCCTGAAGCAACAACTACAGCA
TTTGAATATGAAGATGAAGATGGTGATCGAATTACAGTGAGAAGTGATGAGGAAATGAAGGCAATGCTG
TCATATTATTATTCCACAGTAATGGAACAGCAAGTAAATGGACAGTTAATAGAGCCTCTGCAGATATTT
CCAAGAGCCTGCAAGCCTCCTGGGGAACGGAACATACATGGCCTGAAGGTGAATACTCGGGCCGGACCC
TCTCAACACAGCAGCCCAGCAGTCTCAGATTCACTTCCAAGCAATAGCTTAAAGAAGTCTTCTGCTGAA
CTGAAAAAAATACTAGCCAATGGCCAGATGAATGAACAAGACATACGATATCGGGACACTCTTGGTCAT
GGCAACGGAGGCACAGTCTACAAAGCATATCATGTCCCGAGTGGGAAAATATTAGCTGTAAAGGTCATA
CTACTAGATATTACACTGGAACTTCAGAAGCAAATTATGTCTGAATTGGAAATTCTTTATAAGTGCGAT
TCATCATATATCATTGGATTTTATGGAGCATTTTTTGTAGAAAACAGGATTTCAATATGTACAGAATTC
ATGGATGGGGGATCTTTGGATGTATATAGGAAAATGCCAGAACATGTCCTTGGAAGAATTGCAGTAGCA
GTTGTTAAAGGCCTTACTTATTTGTGGAGTTTAAAGATTTTACATAGAGACGTGAAGCCCTCCAATATG
CTAGTAAACACAAGAGGACAGGTTAAGCTGTGTGATTTTGGAGTTAGCACTCAGCTGGTGAATTCTATA
GCCAAGACGTATGTTGGAACAAATGCTTATATGGCGCCTGAAAGGATTTCAGGGGAGCAGTATGGAATT
CATTCTGATGTCTGGAGCTTAGGAATCTCTTTTATGGAGCTTGCTCTTGGGAGGTTTCCATATCCTCAG
ATTCAGAAAAACCAGGGATCTTTAATGCCTCTCCAGCTTCTGCAGTGCATTGTTGATGAGGATTCGCCC
GTCCTTCCAGTTGGAGAGTTCTCGGAGCCATTTGTACATTTCATCACTCAGTGTATGCGAAAACAGCCA
AAAGAAAGGCCAGCACCTGAAGAATTGATGGGCCACCCGTTCATCGTGCAGTTCAATGATGGAAATGCC
GCCGTGGTGTCCATGTGGGTGTGCCGGGCGCTGGAGGAGAGGCGGAGCCAGCAGGGGCCCCCGTGA

Restriction Sites SgfI-MluI     
ACCN NM_001206804
Insert Size 1239 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001206804.1
RefSeq Size 1801 bp
RefSeq ORF 1239 bp
Locus ID 5607
UniProt ID Q13163
Protein Families Druggable Genome, Protein Kinase
Protein Pathways Gap junction, MAPK signaling pathway, Neurotrophin signaling pathway
MW 46.1 kDa
Gene Summary The protein encoded by this gene is a dual specificity protein kinase that belongs to the MAP kinase kinase family. This kinase specifically interacts with and activates MAPK7/ERK5. This kinase itself can be phosphorylated and activated by MAP3K3/MEKK3, as well as by atypical protein kinase C isoforms (aPKCs). The signal cascade mediated by this kinase is involved in growth factor stimulated cell proliferation and muscle cell differentiation. Three alternatively spliced transcript variants of this gene encoding distinct isoforms have been described. [provided by RefSeq, May 2011]
Transcript Variant: This variant (3) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (C) has a shorter and distinct N-terminus compared to isoform A.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...