SPOCK3 (NM_001204356) Human Untagged Clone

CAT#: SC331567

SPOCK3 (untagged) - Homo sapiens sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3 (SPOCK3), transcript variant 7



  "NM_001204356" in other vectors (2)

CNY 3,710.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


SPOCK3 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HSAJ1454; TES-3; TICN3
Vector pCMV6-Entry
Sequence Data
>SC331567 representing NM_001204356.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCTCAAGGTGTCAGCCGTACTGTGTGTGTGTGCAGCCGCTTGGTGCAGTCAGTCTCTCGCAGCTGCC
GCGGCGGTGGCTGCAGCCGGGGGGCGGTCGGACGGCGGTAATTTTCTGGATGATAAACAATGGCTCACC
ACAATCTCTCAGTATGACAAGGAAGTCGGACAGTGGAACAAATTCCGAGACGATGATTATTTCCGCACT
TGGAGTCCAGGAAAACCCTTCGATCAGGCTTTAGATCCAGCTAAGGATCCATGCTTAAAGATGAAATGT
AGTCGCCATAAAGTATGCATTGCTCAAGATTCTCAGACTGCAGTCTGCATTAGTCACCGGAGGCTTACA
CACAGGATGAAAGAAGCAGGAGTAGACCATAGGCAGTGGAGGGGTCCCATATTATCCACCTGCAAGCAG
TGCCCAGTGGTCTATCCCAGCCCTGTTTGTGGTTCAGATGGTCATACCTACTCTTTTCAGTGCAAACTA
GAATATCAGGCATGTGTCTTAGGAAAACAGATCTCAGTCAAATGTGAAGGACATTGCCCATGTCCTTCA
GATAAGCCCACCAGTACAAGCAGAAATGTTAAGAGAGGATTCGATACCAGCATCTTGCCAATTTGCAAG
GACTCACTTGGCTGGATGTTTAACAGACTTGATACAAACTATGACCTGCTATTGGACCAGTCAGAGCTC
AGAAGCATTTACCTTGATAAGAATGAACAGTGTACCAAGGCATTCTTCAATTCTTGTGACACATACAAG
GACAGTTTAATATCTAATAATGAGTGGTGCTACTGCTTCCAGAGACAGCAAGACCCACCTTGCCAGACT
GAGCTCAGCAATATTCAGAAGCGGCAAGGGGTAAAGAAGCTCCTAGGACAGTATATCCCCCTGTGTGAT
GAAGATGGTTACTACAAGCCAACACAATGTCATGGCAGTGTTGGACAGTGCTGGTGTGTTGACAGATAT
GGAAATGAAGTCATGGGATCCAGAATAAATGGTGTTGCAGATTGTGCTATAGATTTTGAGATCTCCGGA
GATTTTGCTAGTGGCGATTTTCATGAATGGACTGATGATGAGGATGATGAAGACGATATTATGAATGAT
GAAGATGAAATTGAAGATGATGATGAAGATGAAGGGGATGATGATGATGGTGGTGATGACCATGATGTA
TACATTTGA

Restriction Sites SgfI-MluI     
ACCN NM_001204356
Insert Size 1182 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001204356.1
RefSeq Size 2860 bp
RefSeq ORF 1182 bp
Locus ID 50859
UniProt ID Q9BQ16
Protein Families Secreted Protein, Transmembrane
MW 44.3 kDa
Gene Summary This gene encodes a member of a novel family of calcium-binding proteoglycan proteins that contain thyroglobulin type-1 and Kazal-like domains. The encoded protein and may play a role in adult T-cell leukemia by inhibiting the activity of membrane-type matrix metalloproteinases. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011]
Transcript Variant: This variant (7) lacks two alternate in-frame exons compared to variant 2. The resulting isoform (7) has the same N- and C-termini but is shorter compared to isoform 2. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...