p73 (TP73) (NM_001204185) Human Untagged Clone

CAT#: SC331518

TP73 (untagged) - Homo sapiens tumor protein p73 (TP73), transcript variant 9



  "NM_001204185" in other vectors (2)

CNY 4,560.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
TP73 mouse monoclonal antibody, clone OTI2H5 (formerly 2H5)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms P73
Vector pCMV6-Entry
Sequence Data
>SC331518 representing NM_001204185.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCCCAGTCCACCGCCACCTCCCCTGATGGGGGCACCACGTTTGAGCACCTCTGGAGCTCTCTGGAA
CCAGACAGCACCTACTTCGACCTTCCCCAGTCAAGCCGGGGGAATAATGAGGTGGTGGGCGGAACGGAT
TCCAGCATGGACGTCTTCCACCTGGAGGGCATGACTACATCTGTCATGGCCCAGTTCAATCTGCTGAGC
AGCACCATGGACCAGATGAGCAGCCGCGCGGCCTCGGCCAGCCCCTACACCCCAGAGCACGCCGCCAGC
GTGCCCACCCACTCGCCCTACGCACAACCCAGCTCCACCTTCGACACCATGTCGCCGGCGCCTGTCATC
CCCTCCAACACCGACTACCCCGGACCCCACCACTTTGAGGTCACTTTCCAGCAGTCCAGCACGGCCAAG
TCAGCCACCTGGACGTACTCCCCGCTCTTGAAGAAACTCTACTGCCAGATCGCCAAGACATGCCCCATC
CAGATCAAGGTGTCCACCCCGCCACCCCCAGGCACCGCCATCCGGGCCATGCCTGTTTACAAGAAAGCG
GAGCACGTGACCGACGTCGTGAAACGCTGCCCCAACCACGAGCTCGGGAGGGACTTCAACGAAGGACAG
TCTGCTCCAGCCAGCCACCTCATCCGCGTGGAAGGCAATAATCTCTCGCAGTATGTGGATGACCCTGTC
ACCGGCAGGCAGAGCGTCGTGGTGCCCTATGAGCCACCACAGGTGGGGACGGAATTCACCACCATCCTG
TACAACTTCATGTGTAACAGCAGCTGTGTAGGGGGCATGAACCGGCGGCCCATCCTCATCATCATCACC
CTGGAGATGCGGGATGGGCAGGTGCTGGGCCGCCGGTCCTTTGAGGGCCGCATCTGCGCCTGTCCTGGC
CGCGACCGAAAAGCTGATGAGGACCACTACCGGGAGCAGCAGGCCCTGAACGAGAGCTCCGCCAAGAAC
GGGGCCGCCAGCAAGCGTGCCTTCAAGCAGAGCCCCCCTGCCGTCCCCGCCCTTGGTGCCGGTGTGAAG
AAGCGGCGGCATGGAGACGAGGACACGTACTACCTTCAGGTGCGAGGCCGGGAGAACTTTGAGATCCTG
ATGAAGCTGAAAGAGAGCCTGGAGCTGATGGAGTTGGTGCCGCAGCCACTGGTGGACTCCTATCGGCAG
CAGCAGCAGCTCCTACAGAGGCCGCCCCGGGATGCTCAACAACCATGGCCACGCAGTGCCAGCCAACGG
CGAGATGAGCAGCAGCCACAGCGCCCAGTCCATGGTCTCGGGGTCCCACTGCACTCCGCCACCCCCCTA
CCACGCCGACCCCAGCCTCGTCAGTTTTTTAACAGGATTGGGGTGTCCAAACTGCATCGAGTATTTCAC
CTCCCAAGGGTTACAGAGCATTTACCACCTGCAGAACCTGACCATTGA

Restriction Sites SgfI-MluI     
ACCN NM_001204185
Insert Size 1428 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001204185.1
RefSeq Size 5005 bp
RefSeq ORF 1428 bp
Locus ID 7161
UniProt ID O15350
Protein Families Druggable Genome, Transcription Factors
Protein Pathways Neurotrophin signaling pathway, p53 signaling pathway
MW 52.9 kDa
Gene Summary This gene encodes a member of the p53 family of transcription factors involved in cellular responses to stress and development. It maps to a region on chromosome 1p36 that is frequently deleted in neuroblastoma and other tumors, and thought to contain multiple tumor suppressor genes. The demonstration that this gene is monoallelically expressed (likely from the maternal allele), supports the notion that it is a candidate gene for neuroblastoma. Many transcript variants resulting from alternative splicing and/or use of alternate promoters have been found for this gene, but the biological validity and the full-length nature of some variants have not been determined. [provided by RefSeq, Feb 2011]
Transcript Variant: This variant (9) lacks an alternate coding exon compared to variant 1, that causes a frameshift. The resulting isoform (i, also known as TA p73 gamma) has a shorter and distinct C-terminus compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. There are no full-length transcripts supporting this RefSeq in human; it is predicted based on partial transcript alignments and on full-length transcript support reported in PMID:12154353.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...