SHC (SHC1) (NM_001202859) Human Untagged Clone

CAT#: SC331475

SHC1 (untagged) - Homo sapiens SHC (Src homology 2 domain containing) transforming protein 1 (SHC1), transcript variant 5



  "NM_001202859" in other vectors (2)

CNY 4,090.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
Anti-SHC1 (SHC) mouse monoclonal antibody, clone OTI3A1 (formerly 3A1)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms SHC; SHCA
Vector pCMV6-Entry
Sequence Data
>SC331475 representing NM_001202859.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGGACCCGGGGTTTCCTACTTGGTTCGGTACATGGGTTGTGTGGAGGTCCTCCAGTCAATGCGTGCC
CTGGACTTCAACACCCGGACTCAGGTCACCAGGGAGGCCATCAGTCTGGTGTGTGAGGCTGTGCCGGGT
GCTAAGGGGGCGACAAGGAGGAGAAAGCCCTGTAGCCGCCCGCTCAGCTCTATCCTGGGGAGGAGTAAC
CTGAAATTTGCTGGAATGCCAATCACTCTCACCGTCTCCACCAGCAGCCTCAACCTCATGGCCGCAGAC
TGCAAACAGATCATCGCCAACCACCACATGCAATCTATCTCATTTGCATCCGGCGGGGATCCGGACACA
GCCGAGTATGTCGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCACATTCTGGAGTGTCCC
GAAGGGCTTGCCCAGGATGTCATCAGCACCATTGGCCAGGCCTTCGAGTTGCGCTTCAAACAATACCTC
AGGAACCCACCCAAACTGGTCACCCCTCATGACAGGATGGCTGGCTTTGATGGCTCAGCATGGGATGAG
GAGGAGGAAGAGCCACCTGACCATCAGTACTATAATGACTTCCCGGGGAAGGAACCCCCCTTGGGGGGG
GTGGTAGACATGAGGCTTCGGGAAGGAGCCGCTCCAGGGGCTGCTCGACCCACTGCACCCAATGCCCAG
ACCCCCAGCCACTTGGGAGCTACATTGCCTGTAGGACAGCCTGTTGGGGGAGATCCAGAAGTCCGCAAA
CAGATGCCACCTCCACCACCCTGTCCAGGCAGAGAGCTTTTTGATGATCCCTCCTATGTCAACGTCCAG
AACCTAGACAAGGCCCGGCAAGCAGTGGGTGGTGCTGGGCCCCCCAATCCTGCTATCAATGGCAGTGCA
CCCCGGGACCTGTTTGACATGAAGCCCTTCGAAGATGCTCTTCGCGTGCCTCCACCTCCCCAGTCGGTG
TCCATGGCTGAGCAGCTCCGAGGGGAGCCCTGGTTCCATGGGAAGCTGAGCCGGCGGGAGGCTGAGGCA
CTGCTGCAGCTCAATGGGGACTTCCTGGTACGGGAGAGCACGACCACACCTGGCCAGTATGTGCTCACT
GGCTTGCAGAGTGGGCAGCCTAAGCATTTGCTACTGGTGGACCCTGAGGGTGTGGTTCGGACTAAGGAT
CACCGCTTTGAAAGTGTCAGTCACCTTATCAGCTACCACATGGACAATCACTTGCCCATCATCTCTGCG
GGCAGCGAACTGTGTCTACAGCAACCTGTGGAGCGGAAACTGTGA

Restriction Sites SgfI-MluI     
ACCN NM_001202859
Insert Size 1287 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001202859.1
RefSeq Size 3192 bp
RefSeq ORF 1287 bp
Locus ID 6464
UniProt ID P29353
Protein Families Druggable Genome
Protein Pathways Adherens junction, Arrhythmogenic right ventricular cardiomyopathy (ARVC), Chemokine signaling pathway, Chronic myeloid leukemia, Dilated cardiomyopathy, ErbB signaling pathway, Focal adhesion, Glioma, Hypertrophic cardiomyopathy (HCM), Insulin signaling pathway, Leukocyte transendothelial migration, Natural killer cell mediated cytotoxicity, Neurotrophin signaling pathway, Pathogenic Escherichia coli infection, Regulation of actin cytoskeleton, Tight junction, Vibrio cholerae infection, Viral myocarditis
MW 46.7 kDa
Gene Summary This gene encodes three main isoforms that differ in activities and subcellular location. While all three are adapter proteins in signal transduction pathways, the longest (p66Shc) may be involved in regulating life span and the effects of reactive oxygen species. The other two isoforms, p52Shc and p46Shc, link activated receptor tyrosine kinases to the Ras pathway by recruitment of the GRB2/SOS complex. p66Shc is not involved in Ras activation. Unlike the other two isoforms, p46Shc is targeted to the mitochondrial matrix. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
Transcript Variant: This variant (5) has an alternate 5' sequence and an alternate splice site in the CDS, as compared to variant 3. The resulting isoform (5), also known as p46Shc, has a shorter N-terminus and lacks an internal amino acid, as compared to isoform 3. Variants 4 and 5 have the same nucleotide sequence, but variant 5 represents use of a downstream AUG compared to variant 4.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...