Mad (MXD1) (NM_001202513) Human Untagged Clone

CAT#: SC331463

MXD1 (untagged) - Homo sapiens MAX dimerization protein 1 (MXD1), transcript variant 2



  "NM_001202513" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-MXD1 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BHLHC58; MAD; MAD1
Vector pCMV6-Entry
Sequence Data
>SC331463 representing NM_001202513.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCGGCGGCGGTTCGGATGAACATCCAGATGCTGCTGGAGGCGGCCGACTATCTGGAGCGGCGGGAG
AGAGAAGCTGAACATGGTTATGCCTCCATGTTACCATACAATAACAAGGACAGAGATGCCTTAAAACGG
AGGAACAAATCCAAAAAGAATAACAGCAGTAGCAGATCAACTCACAATGAAATGGAGAAGAATAGACGG
GCTCATCTTCGCTTGTGCCTGGAGAAGTTGAAGGGGCTGGTGCCACTTGGACCCGAATCAAGTCGACAC
ACTACGTTGAGTTTATTAACAAAAGCCAAATTGCACATAAAGAAACTTGAAGATTGTGACAGAAAAGCC
GTTCACCAAATCGACCAGCTTCAGCGAGAGCAGCGACACCTGAAGAGGCAGCTGGAGAAGCTGGGCATT
GAGAGGATCCGGATGGACAGCATCGGCTCCACCGTCTCCTCGGAGCGCTCCGACTCCGACAGGGAAATC
GACGTTGACGTGGAGAGCACGGACTATCTCACAGGTGATCTGGACTGGAGCAGCAGCAGTGTGAGCGAC
TCTGACGAGCGGGGCAGCATGCAGAGCCTCGGCAGTGATGAGGGCTATTCCAGCACCAGCATCAAGAGA
ATAAAGCTGCAGGACAGTCACAAGGCGTGTCTTGGTCTCTAA

Restriction Sites SgfI-MluI     
ACCN NM_001202513
Insert Size 663 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001202513.1
RefSeq Size 5627 bp
RefSeq ORF 663 bp
Locus ID 4084
UniProt ID Q05195
Protein Families Druggable Genome, Transcription Factors
MW 25.1 kDa
Gene Summary This gene encodes a member of the MYC/MAX/MAD network of basic helix-loop-helix leucine zipper transcription factors. The MYC/MAX/MAD transcription factors mediate cellular proliferation, differentiation and apoptosis. The encoded protein antagonizes MYC-mediated transcriptional activation of target genes by competing for the binding partner MAX and recruiting repressor complexes containing histone deacetylases. Mutations in this gene may play a role in acute leukemia, and the encoded protein is a potential tumor suppressor. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2011]
Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 3' coding region, compared to variant 1. The encoded isoform (2) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...