HMGN3 (NM_001201363) Human Untagged Clone
CAT#: SC331415
HMGN3 (untagged) - Homo sapiens high mobility group nucleosomal binding domain 3 (HMGN3), transcript variant 4
CNY 2,950.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | PNAS-24; PNAS-25; TRIP7 |
Vector | pCMV6-Entry |
Sequence Data |
>SC331415 representing NM_001201363.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGCCGAAGAGAAAGTCTCCAGAGAATACAGAGGGCAAAGATGGATCCAAAGTAACTAAACAGGAGCCC ACAAGACGGTCTGCCAGATTGTCAGCGAAACCTGCTCCACCAAAACCTGAACCCAAACCAAGAAAAACA TCTGCTAAGAAAGAACCTGGAGCAAAGATTAGCAGAGGTGCTAAAGGGAAGAAGGAGGAAAAGCAGGAA GCTGGAAAGGAAGGTACTGCACCATCTGAAAATGGTGAAACTAAAGCTGAAGAGATCCACATCTCTCGC TCAACTGTTAATGTCTCAACCTCCAGAGGCACCCCACCCAGCACACTGTCAGTAAAGGGGCAGATTGAA ACAGTGAGAGCACAGAAAACTGAATCTGTAGATAACGAGGGAGAATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001201363 |
Insert Size | 393 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001201363.1 |
RefSeq Size | 1028 bp |
RefSeq ORF | 393 bp |
Locus ID | 9324 |
UniProt ID | Q15651 |
Protein Families | Druggable Genome |
MW | 14 kDa |
Gene Summary | The protein encoded by this gene binds thyroid hormone receptor beta in the presence of thyroid hormone. The encoded protein, a member of the HMGN protein family, is thought to reduce the compactness of the chromatin fiber in nucleosomes, thereby enhancing transcription from chromatin templates. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. There is a related pseudogene on chromosome 1. [provided by RefSeq, Jan 2016] Transcript Variant: This variant (4) contains an alternate in-frame exon in the 3' coding region compared to variant 1. The resulting isoform (d) is longer than isoform a. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC233288 | HMGN3 (Myc-DDK tagged) - Homo sapiens high mobility group nucleosomal binding domain 3 (HMGN3), transcript variant 4 |
CNY 3,990.00 |
|
RG233288 | HMGN3 (tGFP-tagged) - Homo sapiens high mobility group nucleosomal binding domain 3 (HMGN3), transcript variant 4 |
CNY 4,370.00 |