HMGN3 (NM_001201362) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	PNAS-24; PNAS-25; TRIP7
Vector	pCMV6-Entry
Sequence Data	Fully Sequenced ORF (showhide) >SC331414 representing NM_001201362. Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGCCGAAGAGAAAGTCTCCAGAGAATACAGAGGGCAAAGATGGATCCAAAGTAACTAAACAGGAGCCC ACAAGACGGTCTGCCAGATTGTCAGCGAAACCTGCTCCACCAAAACCTGAACCCAAACCAAGAAAAACA TCTGCTAAGAAAGAACCTGGAGCAAAGATTAGCAGAGGTGCTAAAGGGAAGAAGGAGGAAAAGCAGGAA GCTGGAAAGGAAGGTACTGCACCATCTGAAAATGGTGAAACTAAAGCTGAAGAGGTACTTTCCATAAAT ACCTCCCACTGA
Restriction Sites	SgfI-MluI
ACCN	NM_001201362
Insert Size	288 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note	Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq	NM_001201362.1
RefSeq Size	1484 bp
RefSeq ORF	288 bp
Locus ID	9324
UniProt ID	Q15651
Protein Families	Druggable Genome
MW	10.2 kDa
Gene Summary	The protein encoded by this gene binds thyroid hormone receptor beta in the presence of thyroid hormone. The encoded protein, a member of the HMGN protein family, is thought to reduce the compactness of the chromatin fiber in nucleosomes, thereby enhancing transcription from chromatin templates. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. There is a related pseudogene on chromosome 1. [provided by RefSeq, Jan 2016] Transcript Variant: This variant (3) retains an alternate segment in the 3' region compared to variant 1, which results in a different 3' coding region and 3' UTR. The resulting isoform (c) is shorter and has a distinct C-terminus compared to isoform a.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.