NPL (NM_001200051) Human Untagged Clone
CAT#: SC331402
NPL (untagged) - Homo sapiens N-acetylneuraminate pyruvate lyase (dihydrodipicolinate synthase) (NPL), transcript variant 4
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C1orf13; C112; NAL; NPL1 |
Vector | pCMV6-Entry |
Sequence Data |
>SC331402 representing NM_001200051.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGCCTTCCCAAAGAAGAAACTTCAGGGTCTTGTGGCTGCAACCATCACGCCAATGACTGAGAATGGA GAAATCAACTTTTCAGTAATTGGTCAGTATGTGGATTATCTTGTGAAAGAACAGGGAGTGAAGAACATT TTTGTGAATGGCACAACAGGAGAAGGCCTGTCCCTGAGCGTCTCAGAGCGTCGCCAGGTTGCAGAGGAG TGGGTGACAAAAGGGAAGGACAAGCTGGATCAGGTGATAATTCACGTAGGAGCACTGAGCTTGAAGGAG TCACAGGAACTGGCCCAACATGCAGCAGAAATAGGAGCTGATGGCATCGCTGTCATTGCACCGTTCTTC CTCAAGCCATGGACCAAAGATATCCTGATTAATTTCCTAAAGGAAGTGGCTGCTGCCGCCCCTGCCCTG CCATTTTATTACTATCACATTCCTGCCTTGACAGGGGTAAAGATTCGTGCTGAGGAGTTGTTGGATGGG ATTCTGGATAAGATCCCCACCTTCCAAGGGCTGAAATTCAGTGATACAGATCTCTTAGACTTCGGGCAA TGTGTTGATCAGAATCGCCAGCAACAGTTTGCTTTCCTTTTTGGGGTGGATGAGTTTTGTATCCAGAGA TTTATCAACTTTGTTGTCAAACTAGAAAACTCAAAACTCAAAGTTTCAAAGAACCAAAGGACTCTTCCT CTGGGCACCACAAACTTCCCCTTCCTCCACTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001200051 |
Insert Size | 723 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001200051.1 |
RefSeq Size | 1856 bp |
RefSeq ORF | 723 bp |
Locus ID | 80896 |
UniProt ID | Q9BXD5 |
Protein Pathways | Amino sugar and nucleotide sugar metabolism |
MW | 26.8 kDa |
Gene Summary | This gene encodes a member of the N-acetylneuraminate lyase sub-family of (beta/alpha)(8)-barrel enzymes. N-acetylneuraminate lyases regulate cellular concentrations of N-acetyl-neuraminic acid (sialic acid) by mediating the reversible conversion of sialic acid into N-acetylmannosamine and pyruvate. A pseudogene of this gene is located on the short arm of chromosome 2. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011] Transcript Variant: This variant (4) has multiple differences in the 3' coding region, compared to variant 1. The encoded isoform (4) is shorter and has a distinct C-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC233519 | NPL (Myc-DDK tagged) - Homo sapiens N-acetylneuraminate pyruvate lyase (dihydrodipicolinate synthase) (NPL), transcript variant 4 |
CNY 3,990.00 |
|
RG233519 | NPL (tGFP-tagged) - Homo sapiens N-acetylneuraminate pyruvate lyase (dihydrodipicolinate synthase) (NPL), transcript variant 4 |
CNY 4,370.00 |