RDH5 (NM_001199771) Human Untagged Clone

CAT#: SC331359

RDH5 (untagged) - Homo sapiens retinol dehydrogenase 5 (11-cis/9-cis) (RDH5), transcript variant 1



  "NM_001199771" in other vectors (2)

CNY 3,140.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


RDH5 rabbit polyclonal antibody
    • 25 ul

CNY 800.00
CNY 1,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms 9cRDH; HSD17B9; RDH1; SDR9C5
Vector pCMV6-Entry
Sequence Data
>SC331359 representing NM_001199771.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTGGCTGCCTCTTCTGCTGGGTGCCTTACTCTGGGCAGTGCTGTGGTTGCTCAGGGACCGGCAGAGC
CTGCCCGCCAGCAATGCCTTTGTCTTCATCACCGGCTGTGACTCAGGCTTTGGGCGCCTTCTGGCACTG
CAGCTGGACCAGAGAGGCTTCCGAGTCCTGGCCAGCTGCCTGACCCCCTCCGGGGCCGAGGACCTGCAG
CGGGTGGCCTCCTCCCGCCTCCACACCACCCTGTTGGATATCACTGATCCCCAGAGCGTCCAGCAGGCA
GCCAAGTGGGTGGAGATGCACGTTAAGGAAGCAGGGCTTTTTGGTCTGGTGAATAATGCTGGTGTGGCT
GGTATCATCGGACCCACACCATGGCTGACCCGGGACGATTTCCAGCGGGTGCTGAATGTGAACACAATG
GGTCCCATCGGGGTCACCCTTGCCCTGCTGCCTCTGCTGCAGCAAGCCCGGGGCCGGGTGATCAACATC
ACCAGCGTCCTGGGTCGCCTGGCAGCCAATGGTGGGGGCTACTGTGTCTCCAAATTTGGCCTGGAGGCC
TTCTCTGACAGCCTGAGGCGGGATGTAGCTCATTTTGGGATACGAGTCTCCATCGTGGAGCCTGGCTTC
TTCCGAACCCCTGTGACCAACCTGGAGAGTCTGGAGAAAACCCTGCAGGCCTGCTGGGCACGGCTGCCT
CCTGCCACACAGGCCCACTATGGGGGGGCCTTCCTCACCAAGTACCTGAAAATGCAACAGCGCATCATG
AACCTGATCTGTGACCCGGACCTAACCAAGGTGAGCCGATGCCTGGAGCATGCCCTGACTGCTCGACAC
CCCCGAACCCGCTACAGCCCAGGTTGGGATGCCAAGCTGCTCTGGCTGCCTGCCTCCTACCTGCCAGCC
AGCCTGGTGGATGCTGTGCTCACCTGGGTCCTTCCCAAGCCTGCCCAAGCAGTCTACTGA

Restriction Sites SgfI-MluI     
ACCN NM_001199771
Insert Size 957 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001199771.1
RefSeq Size 1359 bp
RefSeq ORF 957 bp
Locus ID 5959
UniProt ID Q92781
Protein Families Druggable Genome
Protein Pathways Retinol metabolism
MW 35 kDa
Gene Summary This gene encodes an enzyme belonging to the short-chain dehydrogenases/reductases (SDR) family. This retinol dehydrogenase functions to catalyze the final step in the biosynthesis of 11-cis retinaldehyde, which is the universal chromophore of visual pigments. Mutations in this gene cause autosomal recessive fundus albipunctatus, a rare form of night blindness that is characterized by a delay in the regeneration of cone and rod photopigments. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the neighboring upstream BLOC1S1 (biogenesis of lysosomal organelles complex-1, subunit 1) gene. [provided by RefSeq, Dec 2010]
Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...