MLC1SA (MYL6B) (NM_001199629) Human Untagged Clone

CAT#: SC331332

MYL6B (untagged) - Homo sapiens myosin, light chain 6B, alkali, smooth muscle and non-muscle (MYL6B), transcript variant 1



  "NM_001199629" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
MYL6B mouse monoclonal antibody,clone OTI7F10
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms MLC1SA
Vector pCMV6-Entry
Sequence Data
>SC331332 representing NM_001199629.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCCTCCCAAGAAGGATGTTCCCGTGAAGAAACCAGCAGGGCCCTCCATCTCCAAACCTGCTGCTAAG
CCAGCAGCAGCAGGGGCTCCTCCAGCCAAGACCAAAGCTGAGCCAGCTGTCCCCCAGGCCCCTCAGAAA
ACCCAGGAGCCTCCAGTCGATCTCTCCAAAGTGGTGATCGAGTTTAACAAGGACCAGCTGGAGGAGTTC
AAGGAGGCCTTCGAGCTGTTTGACCGAGTGGGGGATGGCAAGATCCTGTACAGCCAGTGTGGGGACGTG
ATGAGGGCCCTGGGCCAGAACCCCACCAACGCCGAGGTGCTCAAGGTCCTGGGGAACCCCAAGAGTGAT
GAGCTGAAGTCGCGGCGTGTGGACTTTGAGACTTTCCTGCCCATGCTCCAGGCAGTGGCCAAGAACCGA
GGCCAAGGCACATATGAGGACTACTTGGAGGGGTTTCGTGTGTTTGACAAGGAGGGGAACGGCAAAGTC
ATGGGAGCAGAGCTCAGACATGTTCTCACCACCCTTGGAGAGAAGATGACTGAGGAGGAGGTGGAGACC
GTTCTGGCAGGACACGAGGACAGCAACGGCTGCATCAACTACGAGGCCTTCTTGAAACACATCCTAAGC
GTCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001199629
Insert Size 627 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001199629.1
RefSeq Size 1072 bp
RefSeq ORF 627 bp
Locus ID 140465
UniProt ID P14649
Protein Pathways Vascular smooth muscle contraction
MW 22.8 kDa
Gene Summary Myosin is a hexameric ATPase cellular motor protein. It is composed of two heavy chains, two nonphosphorylatable alkali light chains, and two phosphorylatable regulatory light chains. This gene encodes a myosin alkali light chain expressed in both slow-twitch skeletal muscle and in nonmuscle tissue. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2010]
Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...