CMTM2 (NM_001199317) Human Untagged Clone

CAT#: SC331296

CMTM2 (untagged) - Homo sapiens CKLF-like MARVEL transmembrane domain containing 2 (CMTM2), transcript variant 2



  "NM_001199317" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-CMTM2 Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CKLFSF2
Vector pCMV6-Entry
Sequence Data
>SC331296 representing NM_001199317.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCACCTAAGGCGGCAAAGGGGGCCAAGCCAGAGCCAGCACCAGCTCCACCTCCACCCGGGGCCAAA
CCCGAGGAAGACAAGAAGGACGGTAAGGAGCCATCGGACAAACCTCAAAAGGCGGTGCAGGACCATAAG
GAGCCATCGGACAAACCTCAAAAGGCGGTGCAGCCCAAGCACGAAGTGGGCACGAGGAGGGGGTGTCGC
CGCTACCGGTGGGAATTAAAAGACAGCAATAAAGAGTTCTGGCTCTTGGGGCACGCTGAGATCAAGATT
CGGAGTTTGGACCTCTTCAACGACCTGATTGCTTGTGCGTTCCTTGTGGGAGCCGTGGTCTTTGCTGTG
AGAAGTCGGCGATCCATGAATCTCCACTACTTACTTGCTGTGATCCTTATTGGTGCGGCTGGAGTTTTT
GCTTTTATCGATGTGTGTCTTCAAAGAAACCACTTCAGAGGCAAGAAGGCCAAAAAGCATATGCTGGTT
CCTCCTCCAGGAAAGGAAAAAGGACCCCAGCAGGGCAAGGGACCAGAACCCGCCAAGCCACCAGAACCT
GGCAAGCCACCAGGGCCAGCAAAGGGAAAGAAATGA

Restriction Sites SgfI-MluI     
ACCN NM_001199317
Insert Size 588 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001199317.1
RefSeq Size 914 bp
RefSeq ORF 588 bp
Locus ID 146225
UniProt ID Q8TAZ6
Protein Families Transmembrane
MW 21.4 kDa
Gene Summary This gene belongs to the chemokine-like factor gene superfamily, a novel family that links the chemokine and the transmembrane 4 superfamilies of signaling molecules. The protein encoded by this gene may play an important role in testicular development. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) lacks an in-frame exon in the coding region, compared to variant 1. The resulting protein (isoform 2) is shorter, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...