PHOSPHO2 (NM_001199288) Human Untagged Clone

CAT#: SC331294

PHOSPHO2 (untagged) - Homo sapiens phosphatase, orphan 2 (PHOSPHO2), transcript variant 5



  "NM_001199288" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-PHOSPHO2 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
Sequence Data
>SC331294 representing NM_001199288.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAAAATTTTGCTAGTTTTTGACTTTGACAATACAATCATAGATGACAATAGTGACACTTGGATTGTA
CAATGTGCTCCCAACAAAAAGCTTCCTATTGAACTACGTGATTCTTATCGAAAAGGATTTTGGACAGAA
TTTATGGGCAGAGTCTTTAAGTATTTGGGAGATAAGGGTGTAAGAGAACATGAAATGAAAAGAGCAGTG
ACATCATTGCCTTTCACTCCAGGGATGGTGGAACTCTTCAACTTTATAAGAAAGAATAAGGATAAATTT
GACTGCATTATTATTTCAGATTCAAATTCGGTCTTCATAGATTGGGTTTTAGAAGCTGCCAGTTTTCAT
GACATATTTGATAAAGTGTTTACAAATCCAGCAGCTTTTAATAGCAATGGTCATCTCACTGTTGAAAAT
TATCATACTCATTCTTGCAATAGATGCCCAAAGAATCTTTGCAAAAAGGTAGTTTTGATAGAATTTGTA
GATAAACAGTTACAACAGGGAGTGAATTATACACAAATTGTTTATATTGGTGATGGTGGAAATGATGTC
TGTCCAGTCACCTTTTTAAAGAATGATGATGTTGCCATGCCACGGAAAGGATATACCTTACAGAAAACT
CTTTCCAGAATGTCTCAAAATCTTGAGCCTATGGAATATTCTGTTGTAGTTTGGTCCTCAGGTGTTGAT
ATAATTTCTCATTTACAATTTCTAATAAAGGATTAA

Restriction Sites SgfI-MluI     
ACCN NM_001199288
Insert Size 726 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001199288.1
RefSeq Size 1068 bp
RefSeq ORF 726 bp
Locus ID 493911
UniProt ID Q8TCD6
MW 27.8 kDa
Gene Summary Phosphatase that has high activity toward pyridoxal 5'-phosphate (PLP). Also active at much lower level toward pyrophosphate, phosphoethanolamine (PEA), phosphocholine (PCho), phospho-l-tyrosine, fructose-6-phosphate, p-nitrophenyl phosphate, and h-glycerophosphate.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (5) differs in the 5' UTR compared to variant 1. All variants (1-5) encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...