TRAF1 (NM_001190945) Human Untagged Clone

CAT#: SC331145

TRAF1 (untagged) - Homo sapiens TNF receptor-associated factor 1 (TRAF1), transcript variant 2



  "NM_001190945" in other vectors (2)

CNY 3,990.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Anti-TRAF1 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms EBI6; MGC:10353
Vector pCMV6-Entry
Sequence Data
>SC331145 representing NM_001190945.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCCTCCAGCTCAGGCAGCAGTCCTCGCCCGGCCCCTGATGAGAATGAGTTTCCCTTTGGGTGCCCT
CCCACCGTCTGCCAGGACCCAAAGGAGCCCAGGGCTCTCTGCTGTGCAGGCTGTCTCTCTGAGAACCCG
AGGAATGGCGAGGATCAGATCTGCCCCAAATGCAGAGGGGAAGACCTCCAGTCTATAAGCCCAGGAAGC
CGTCTTCGAACTCAGGAGAAGGCTCACCCCGAGGTGGCTGAGGCTGGAATTGGGTGCCCCTTTGCAGGT
GTCGGCTGCTCCTTCAAGGGAAGCCCACAGTCTGTGCAAGAGCATGAGGTCACCTCCCAGACCTCCCAC
CTAAACCTGCTGTTGGGGTTCATGAAACAGTGGAAGGCCCGGCTGGGCTGTGGCCTGGAGTCTGGGCCC
ATGGCCCTGGAGCAGAACCTGTCAGACCTGCAGCTGCAGGCAGCCGTGGAAGTGGCGGGGGACCTGGAG
GTCGATTGCTACCGGGCACCCTGCTCCGAGAGCCAGGAGGAGCTGGCCCTGCAGCACTTCATGAAGGAG
AAGCTTCTGGCTGAGCTGGAGGGGAAGCTGCGTGTGTTTGAGAACATTGTTGCTGTCCTCAACAAGGAG
GTGGAGGCCTCCCACCTGGCCCTGGCCACCTCTATCCACCAGAGCCAGCTGGACCGTGAGCGCATCCTG
AGCTTGGAGCAGAGGGTGGTGGAGCTTCAGCAGACCCTGGCCCAGAAAGACCAGGCCCTGGGCAAGCTG
GAGCAGAGCTTGCGCCTCATGGAGGAGGCCTCCTTCGATGGCACTTTCCTGTGGAAGATCACCAATGTC
ACCAGGCGGTGCCATGAGTCGGCCTGTGGCAGGACCGTCAGCCTCTTCTCCCCAGCCTTCTACACTGCC
AAGTATGGCTACAAGTTGTGCCTGCGGCTGTACCTGAATGGAGATGGCACTGGAAAGAGAACCCATCTG
TCGCTCTTCATCGTGATCATGAGAGGGGAGTATGATGCGCTGCTGCCGTGGCCCTTCCGGAACAAGGTC
ACCTTCATGCTGCTGGACCAGAACAACCGTGAGCACGCCATTGACGCCTTCCGGCCTGACCTAAGCTCA
GCGTCCTTCCAGAGGCCCCAGAGTGAAACCAACGTGGCCAGTGGATGCCCACTCTTCTTCCCCCTCAGC
AAACTGCAGTCACCCAAGCACGCCTACGTGAAGGACGACACAATGTTCCTCAAGTGCATTGTGGAGACC
AGCACTTAG

Restriction Sites SgfI-MluI     
ACCN NM_001190945
Insert Size 1251 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001190945.1
RefSeq Size 4303 bp
RefSeq ORF 1251 bp
Locus ID 7185
UniProt ID Q13077
Protein Families Druggable Genome
Protein Pathways Pathways in cancer, Small cell lung cancer
MW 46.2 kDa
Gene Summary The protein encoded by this gene is a member of the TNF receptor (TNFR) associated factor (TRAF) protein family. TRAF proteins associate with, and mediate the signal transduction from various receptors of the TNFR superfamily. This protein and TRAF2 form a heterodimeric complex, which is required for TNF-alpha-mediated activation of MAPK8/JNK and NF-kappaB. The protein complex formed by this protein and TRAF2 also interacts with inhibitor-of-apoptosis proteins (IAPs), and thus mediates the anti-apoptotic signals from TNF receptors. The expression of this protein can be induced by Epstein-Barr virus (EBV). EBV infection membrane protein 1 (LMP1) is found to interact with this and other TRAF proteins; this interaction is thought to link LMP1-mediated B lymphocyte transformation to the signal transduction from TNFR family receptors. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
Transcript Variant: This variant (2) differs in the 5' UTR compared to isoform 1. Variants 1 and 2 both encode the same isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...