MBD4 (NM_001276273) Human Untagged Clone

CAT#: SC331040

MBD4 (untagged) - Homo sapiens methyl-CpG binding domain protein 4 (MBD4), transcript variant 5



  "NM_001276273" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal MBD4 Antibody
    • 100 ul

CNY 5,381.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms MED1
Vector pCMV6-Entry
Sequence Data
>SC331040 representing NM_001276273.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGGCACGACTGGGCTGGAGAGTCTGAGTCTGGGGGACCGCGGAGCTGCCCCCACCGTCACCTCTAGT
GAGCGCCTAGTCCCAGACCCGCCGAATGACCTCCGCAAAGAAGATGTTGCTATGGAATTGGAAAGAGTG
GGAGAAGATGAGGAACAAATGATGATAAAAAGAAGCAGTGAATGTAATCCCTTGCTACAAGAACCCATC
GCTTCTGCTCAGTTTGGTGCTACTGCAGGAACAGAATGCCAAGATACCATCCCACGAACACAGATAGAA
AGAAGGAAAACAAGCCTGTATTTTTCCAGCAAATATAACAAAGAAGCTCTTAGCCCCCCACGACGTAAA
GCCTTTAAGAAATGGACACCTCCTCGGTCACCTTTTAATCTCGTTCAAGAAACACTTTTTCATGATCCA
TGGAAGCTTCTCATCGCTACTATATTTCTCAATCGGACCTCAGGCAAAATGGCAATACCTGTGCTTTGG
AAGTTTCTGGAGAAGTATCCTTCAGCTGAGGTAGCAAGAACCGCAGACTGGAGAGATGTGTCAGAACTT
CTTAAACCTCTTGGTCTCTACGATCTTCGGGCAAAAACCATTGTCAAGTTCTCAGATGAATACCTGACA
AAGCAGTGGAAGTATCCAATTGAGCTTCATGGGATTGGTAAATATGGCAACGACTCTTACCGAATTTTT
TGTGTCAATGAGTGGAAGCAGGTGCACCCTGAAGACCACAAATTAAATAAATATCATGACTGGCTTTGG
GAAAATCATGAAAAATTAAGTCTATCTTAA

Restriction Sites SgfI-MluI     
ACCN NM_001276273
Insert Size 789 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001276273.1
RefSeq Size 1706 bp
RefSeq ORF 789 bp
Locus ID 8930
UniProt ID O95243
Protein Families Druggable Genome
Protein Pathways Base excision repair
MW 30.3 kDa
Gene Summary The protein encoded by this gene is a member of a family of nuclear proteins related by the presence of a methyl-CpG binding domain (MBD). These proteins are capable of binding specifically to methylated DNA, and some members can also repress transcription from methylated gene promoters. This protein contains an MBD domain at the N-terminus that functions both in binding to methylated DNA and in protein interactions and a C-terminal mismatch-specific glycosylase domain that is involved in DNA repair. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2013]
Transcript Variant: This variant (5) uses an alternate in-frame splice site and lacks an exon in the 5' coding region, compared to variant 1. The encoded isoform (5) is shorter, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...