DUOXA1 (NM_001276268) Human Untagged Clone

CAT#: SC331039

DUOXA1 (untagged) - Homo sapiens dual oxidase maturation factor 1 (DUOXA1), transcript variant 6



  "NM_001276268" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
DUOXA1 Antibody - C-terminal region
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms mol; NIP; NUMBIP
Vector pCMV6-Entry
Sequence Data
>SC331039 representing NM_001276268.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCTACTTTGGGACACACATTCCCCTTCTATGCTGGCCCCAAGCCAACCTTCCCGATGGACACCACT
TTGGCCAGCATCATCATGATCTTTCTGACTGCACTGGCCACGTTCATCGTCATCCTGCCTGGCATTCGG
GGAAAGACGAGGCTGTTCTGGCTGCTTCGGGTGGTGACCAGCTTATTCATCGGGGCTGCAATCCTGGGG
ACCCCCGTGCAGCAGCTGAATGAGACCATCAATTACAACGAGGAGTTCACCTGGCGCCTGGGTGAGAAC
TATGCTGAGGAGTATGCAAAGGCTCTGGAGAAGGGGCTGCCAGACCCTGTGTTGTACCTAGCTGAGAAG
TTCACTCCAAGAAGCCCATGTGGCCTATACCGCCAGTACCGCCTGGCGGGACACTACACCTCAGCCATG
CTATGGGTGGCATTCCTCTGCTGGCTGCTGGCCAATGTGATGCTCTCCATGCCTGTGCTGGTATATGGT
GGCTACATGCTATTGGCCACGGGCATCTTCCAGCTGTTGGCTCTGCTCTTCTTCTCCATGGCCACATCA
CTCACCTCACCCTGTCCCCTGCACCTGGGCGCTTCTGTGCTGCATACTCACCATGGGCCTGCCTTCTGG
ATCACATTGACCACAGGACTGCTGTGTGTGCTGCTGGGCCTGGCTATGGCGGTGGCCCACAGGATGCAG
CCTCACAGGCTGAAGGCTTTCTTCAACCAGAGTGTGGATGAAGACCCCATGCTGGAGTGGAGTCCTGAG
GAAGGTGGACTCCTGAGCCCCCGCTACCGGTCCATGGCTGACAGTCCCAAGTCCCAGGACATTCCCCTG
TCAGAGGCTTCCTCCACCAAGGCATACTGTAAGGAGGCACACCCCAAAGATCCTGATTGTGCTTTATAA

Restriction Sites SgfI-MluI     
ACCN NM_001276268
Insert Size 897 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001276268.1
RefSeq Size 2709 bp
RefSeq ORF 897 bp
Locus ID 90527
UniProt ID Q1HG43
Protein Families Transmembrane
MW 33.1 kDa
Gene Summary Dual oxidases DUOX1 and DUOX2 are NADPH oxidases which are involved in hydrogen peroxide production necessary for thyroid hormonogenesis. They form a heterodimer with specific maturation factors DUOXA1 and DUOXA2, respectively, which is essential for the maturation and function of the DUOX enzyme complexes. This gene encodes the DUOX1 activator or maturation factor DUOXA1. Rat studies identified a bidirectional promoter which controls the transcription of the DUOX1 and DUOXA1 genes. This protein is cotransported to the cell surface when coexpressed with DUOX1 and is retained in the endoplasmic reticulum when expressed without DUOX1 protein. The expression of this gene or the DUOX1 gene is not suppressed by thyroglobulin (Tg), a macromolecular precursor in thyroid hormone synthesis, while the expression of the DUOX2 and DUOXA2 are significantly suppressed by the Tg. This protein is also a p53-regulated neurogenic factor involved in p53 dependent neuronal differentiation. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2013]
Transcript Variant: This variant (6) differs in the 5' and 3' UTRs and 3' coding region compared to variant 1. The resulting isoform (4, also known as beta) is shorter and has a distinct C-terminus, compared to isoform 1. Variants 5 and 6 encode the same isoform 4.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...