Thymidine Kinase 2 (TK2) (NM_001272050) Human Untagged Clone

CAT#: SC331029

TK2 (untagged) - Homo sapiens thymidine kinase 2, mitochondrial (TK2), transcript variant 9



  "NM_001272050" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TK2 Antibody - C-terminal region
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms MTDPS2; MTTK; PEOB3; SCA31
Vector pCMV6-Entry
Sequence Data
>SC331029 representing NM_001272050.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTACCACGATGCCTCTCGCTGGGGTCTTACGCTACAGACTTATGTGCAGCTCACCATGCTGGACAGG
CATACTCGTCCTCAGGTGTCATCTGTACGGTTGATGGAGAGGTCGATTCACAGCGCAAGATACATTTTT
GTAGAAAACCTGTATAGAAGTGGGAAGATGCCAGAAGTGGACTATGTAGTTCTGTCGGAATGGTTTGAC
TGGATCTTGAGGAACATGGACGTGTCTGTTGATTTGATAGTTTACCTTCGGACCAATCCTGAGACTTGT
TACCAGAGGTTAAAGAAGAGATGCAGGGAAGAGGAGAAGGTCATTCCGCTGGAATACCTGGAAGCAATT
CACCATCTCCATGAGGAGTGGCTCATCAAAGGCAGCCTTTTCCCCATGGCAGCCCCTGTTCTGGTGATT
GAGGCTGACCACCACATGGAGAGGATGTTAGAACTCTTTGAACAAAATCGGGATCGAATATTAACTCCA
GAGAATCGGAAGCATTGCCCATAG

Restriction Sites SgfI-MluI     
ACCN NM_001272050
Insert Size 507 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001272050.1
RefSeq Size 4907 bp
RefSeq ORF 507 bp
Locus ID 7084
UniProt ID O00142
Protein Families Druggable Genome
Protein Pathways Drug metabolism - other enzymes, Metabolic pathways, Pyrimidine metabolism
MW 20.3 kDa
Gene Summary This gene encodes a deoxyribonucleoside kinase that specifically phosphorylates thymidine, deoxycytidine, and deoxyuridine. The encoded enzyme localizes to the mitochondria and is required for mitochondrial DNA synthesis. Mutations in this gene are associated with a myopathic form of mitochondrial DNA depletion syndrome. Alternate splicing results in multiple transcript variants encoding distinct isoforms, some of which lack transit peptide, so are not localized to mitochondria. [provided by RefSeq, Dec 2012]
Transcript Variant: This variant (9) contains an alternate 5' exon and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (7) has a shorter N-terminus, compared to isoform 1, but is predicted to be a mitochondrial protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...