HSPC210 (GSKIP) (NM_001271904) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	C14orf129; HSPC210
Vector	pCMV6-Entry
Sequence Data	Fully Sequenced ORF (showhide) >SC331001 representing NM_001271904. Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGAAACAGACTGTAATCCCATGGAGCTAAGCAGTATGTCAGGATTTGAAGAAGGTTCAGAGCTGAAC GGTTTTGAAGGAACTGACATGAAAGACATGAGGCTCGAAGCTGAAGCAGTTGTAAATGATGTTCTCTTT GCTGTTAACAACATGTTTGTCTCGAAAAGCCTGCGGTGTGCGGATGATGTGGCCTATATCAATGTGGAA ACAAAGGAAAGAAACAGATATTGCCTAGAACTCACTGAAGCAGGGCTCAAGGTGGTAGGCTATGCTTTT GACCAGGTAGATGATCATTTACAGACTCCCTACCATGAAACAGTCTACTCCTTGTTGGATACACTCAGC CCCGCCTACCGAGAAGCATTTGGAAACGCACTGCTTCAAAGACTGGAAGCTTTGAAAAGAGATGGACAG TCATGA
Restriction Sites	SgfI-MluI
ACCN	NM_001271904
Insert Size	420 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note	Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq	NM_001271904.1
RefSeq Size	2665 bp
RefSeq ORF	420 bp
Locus ID	51527
UniProt ID	Q9P0R6
MW	15.6 kDa
Gene Summary	This gene encodes a protein that is involved as a negative regulator of GSK3-beta in the Wnt signaling pathway. The encoded protein may play a role in the retinoic acid signaling pathway by regulating the functional interactions between GSK3-beta, beta-catenin and cyclin D1, and it regulates the beta-catenin/N-cadherin pool. The encoded protein contains a GSK3-beta interacting domain (GID) in its C-terminus, which is similar to the GID of Axin. The protein also contains an evolutionarily conserved RII-binding domain, which facilitates binding with protein kinase-A and GSK3-beta, enabling its role as an A-kinase anchoring protein. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Dec 2012] Transcript Variant: This variant (1) represents the longest transcript. Variants 1, 2, 3 and 4 encode the same protein.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.