TREML1 (NM_001271808) Human Untagged Clone

CAT#: SC330971

TREML1 (untagged) - Homo sapiens triggering receptor expressed on myeloid cells-like 1 (TREML1), transcript variant 3



  "NM_001271808" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Goat Anti-TREML1 Antibody
    • 100 ug

CNY 5,371.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms dJ238O23.3; GLTL1825; PRO3438; TLT-1; TLT1
Vector pCMV6-Entry
Sequence Data
>SC330971 representing NM_001271808.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGGCCTCACCCTGCTCTTGCTGCTGCTCCTGGGACTAGAAGAGGAAGAAGAAGAGACCCATAAGATT
GGCAGTCTGGCTGAGAACGCATTCTCAGACCCTGCAGGCAGTGCCAACCCTTTGGAACCCAGCCAGGAT
GAGAAGAGCATCCCCTTGATCTGGGGTGCTGTGCTCCTGGTAGGTCTGCTGGTGGCAGCGGTGGTGCTG
TTTGCTGTGATGGCCAAGAGGAAACAAGGGAACAGGCTTGGTGTCTGTGGCCGATTCCTGAGCAGCAGA
GTTTCAGGCATGAATCCCTCCTCAGTGGTCCACCACGTCAGTGACTCTGGACCGGCTGCTGAATTGCCT
TTGGATGTACCACACATTAGGCTTGACTCACCACCTTCATTTGACAATACCACCTACACCAGCCTACCT
CTTGATTCCCCATCAGGAAAACCTTCACTCCCAGCTCCATCCTCATTGCCCCCTCTACCTCCTAAGGTC
CTGGTCTGCTCCAAGCCTGTGACATATGCCACAGTAATCTTCCCGGGAGGGAACAAGGGTGGAGGGACC
TCGTGTGGGCCAGCCCAGAATCCACCTAACAATCAGACTCCATCCAGCTAA

Restriction Sites SgfI-MluI     
ACCN NM_001271808
Insert Size 603 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001271808.1
RefSeq Size 1023 bp
RefSeq ORF 603 bp
Locus ID 340205
UniProt ID Q86YW5
Protein Families Druggable Genome, Transmembrane
MW 20.7 kDa
Gene Summary This gene encodes a member of the triggering receptor expressed on myeloid cells-like (TREM) family. The encoded protein is a type 1 single Ig domain orphan receptor localized to the alpha-granule membranes of platelets. The encoded protein is involved in platelet aggregation, inflammation, and cellular activation and has been linked to Gray platelet syndrome. Alternative splicing results in multiple transcript variants [provided by RefSeq, Nov 2012]
Transcript Variant: This variant (3) lacks an in-frame exon in the coding region, compared to variant 1. The encoded isoform (c) is shorter compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...