RQCD1 (CNOT9) (NM_001271635) Human Untagged Clone
CAT#: SC330946
RQCD1 (untagged) - Homo sapiens RCD1 required for cell differentiation1 homolog (S. pombe) (RQCD1), transcript variant 3
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CAF40; CT129; RCD-1; RCD1; RQCD1 |
Vector | pCMV6-Entry |
Sequence Data |
>SC330946 representing NM_001271635.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGCACAGCCTGGCGACGGCTGCGCCTGTGCCTACTACACTGGCACAAGTGGATAGAGAAAAGATCTAT CAGTGGATCAATGAGCTGTCCAGTCCTGAGACTAGGGAAAATGCTTTGCTGGAGCTAAGTAAGAAGCGA GAATCTGTTCCTGACCTTGCACCCATGCTGTGGCATTCATTTGGTACTATTGCAGCACTTTTACAGGAA ATTGTAAATATTTATCCATCTATCAACCCACCCACCTTGACAGCACACCAGTCTAACAGAGTTTGCAAT GCTCTGGCATTACTGCAATGTGTAGCATCACATCCAGAAACCAGGTCAGCGTTTCTCGCAGCACACATC CCACTTTTTTTGTACCCCTTTTTGCACACTGTCAGCAAAACACGTCCCTTTGAGTATCTCCGGCTCACC AGCCTTGGAGTTATTGGGGCCCTGGTGAAAACAGATGAACAAGAAGTAATCAACTTTTTATTAACAACA GAAATTATCCCTTTATGTTTGCGAATTATGGAATCTGGAAGTGAACTTTCTAAAACAGTTGCCACATTC ATCCTCCAGAAGATCTTGTTAGATGACACTGGTTTGGCTTATATATGTCAGACGTATGAGCGTTTCTCC CATGTTGCCATGATCTTGGGTAAGATGGTCCTGCAGCTATCCAAAGAGCCTTCTGCCCGTCTGCTGAAG CATGTAGTGAGATGTTACCTTCGACTTTCAGATAACCCCAGGTTTTCAGATTTGACTTTCTGCTGGTCA TCTTTTCAAAGAAAATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001271635 |
Insert Size | 777 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001271635.1 |
RefSeq Size | 1444 bp |
RefSeq ORF | 777 bp |
Locus ID | 9125 |
UniProt ID | Q92600 |
Protein Pathways | RNA degradation |
MW | 29.1 kDa |
Gene Summary | This gene encodes a member of the highly conserved RCD1 protein family. The encoded protein is a transcriptional cofactor and a core protein of the CCR4-NOT complex. It may be involved in signal transduction as well as retinoic acid-regulated cell differentiation and development. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Oct 2012] Transcript Variant: This variant (3) lacks an alternate in-frame exon in the coding region and includes an alternate terminal exon, compared to variant 1. It encodes isoform 3 which is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC232306 | RQCD1 (Myc-DDK tagged) - Homo sapiens RCD1 required for cell differentiation1 homolog (S. pombe) (RQCD1), transcript variant 3 |
CNY 3,990.00 |
|
RG232306 | RQCD1 (tGFP-tagged) - Homo sapiens RCD1 required for cell differentiation1 homolog (S. pombe) (RQCD1), transcript variant 3 |
CNY 4,370.00 |