CD16b (FCGR3B) (NM_001271037) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	CD16; CD16A; CD16b; FCG3; FCGR3; FCGR3A; FCR-10; FCRIII; FCRIIIb
Vector	pCMV6-Entry
Sequence Data	Fully Sequenced ORF (showhide) >SC330920 representing NM_001271037. Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGCGGACTGAAGATCTCCCAAAGGCTGTGGTGTTCCTGGAGCCTCAATGGTACAGCGTGCTTGAGAAG GACAGTGTGACTCTGAAGTGCCAGGGAGCCTACTCCCCTGAGGACAATTCCACACAGTGGTTTCACAAT GAGAACCTCATCTCAAGCCAGGCCTCGAGCTACTTCATTGACGCTGCCACAGTCAACGACAGTGGAGAG TACAGGTGCCAGACAAACCTCTCCACCCTCAGTGACCCGGTGCAGCTAGAAGTCCATATCGGTTTGGCA GTGTCAACCATCTCATCATTCTCTCCACCTGGGTACCAAGTCTCTTTCTGCTTGGTGATGGTACTCCTT TTTGCAGTGGACACAGGACTATATTTCTCTGTGAAGACAAACATTTGA
Restriction Sites	SgfI-MluI
ACCN	NM_001271037
Insert Size	393 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq	NM_001271037.1
RefSeq Size	2002 bp
RefSeq ORF	393 bp
Locus ID	2215
UniProt ID	O75015
Protein Families	ES Cell Differentiation/IPS, Secreted Protein, Transmembrane
Protein Pathways	Natural killer cell mediated cytotoxicity, Systemic lupus erythematosus
MW	14.4 kDa
Gene Summary	The protein encoded by this gene is a low affinity receptor for the Fc region of gamma immunoglobulins (IgG). The encoded protein acts as a monomer and can bind either monomeric or aggregated IgG. This gene may function to capture immune complexes in the peripheral circulation. Several transcript variants encoding different isoforms have been found for this gene. A highly-similar gene encoding a related protein is also found on chromosome 1. [provided by RefSeq, Aug 2012] Transcript Variant: This variant (5) differs in the 5' UTR and coding sequence and lacks an alternate in-frame exon compared to variant 1. The resulting isoform (5) is shorter at the N-terminus and lacks an alternate internal segment compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.