Mitochondrial dicarboxylate carrier (SLC25A10) (NM_001270888) Human Untagged Clone

CAT#: SC330883

SLC25A10 (untagged) - Homo sapiens solute carrier family 25 (mitochondrial carrier, dicarboxylate transporter), member 10 (SLC25A10), transcript variant 1



  "NM_001270888" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-SLC25A10 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DIC; MTDPS19
Vector pCMV6-Entry
Sequence Data
>SC330883 representing NM_001270888.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCAGCCGAGGCGCGCGTGTCGCGCTGGTACTTCGGGGGGCTGGCCTCCTGCGGGGCCGCCTGCTGC
ACGCACCCGCTGGACCTGCTCAAGGTGCATCTGCAGACGCAGCAGGAGGTGAAGCTGCGCATGACGGGC
ATGGCGCTGCGGGTGGTGCGTACCGACGGCATCCTGGCACTCTACAGCGGCCTGAGCGCCTCGCTGTGC
AGACAGATGACCTACTCCCTGACTCGGTTCGCCATCTACGAGACTGTGCGGGACCGTGTGGCCAAGGGC
AGCCAGGGGCCTCTCCCCTTCCACGAGAAGGTGTTGCTGGGCTCCGTCAGCGGTTTAGCTGGAGGCTTC
GTGGGGACGCCCGCAGACTTGGTCAACGTCAGGATGCAGAACGACGTGAAGCTGCCCCAGGGTCAGCGG
CGCAACTACGCCCATGCGCTGGATGGCCTGTACCGCGTAGCTCGTGAAGAGGGTCTCAGGAGACTGTTC
TCGGGTGCAACCATGGCATCCAGCCGAGGGGCCTTAGTCACTGTGGGCCAGCTGTCCTGCTACGACCAG
GCCAAGCAGCTGGTCCTTAGCACCGGGTACCTCTCTGACAACATCTTCACTCACTTTGTCGCCAGCTTT
ATTGCAGCCGCTGGTGACGAGCCCCCTCCTCAGGGTGGATGTGCCACGTTCCTGTGCCAGCCCCTGGAT
GTGCTGAAGACTCGCCTGATGAACTCCAAGGGGGAGTATCAGGGCGTTTTCCACTGCGCCGTGGAGACA
GCGAAGCTCGGGCCTCTGGCCTTTTACAAGGGCCTCGTCCCAGCTGGCATCCGCCTCATCCCCCACACC
GTGCTCACTTTTGTGTTTCTGGAACAGCTACGCAAAAACTTTGGCATCAAAGTGCCATCCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001270888
Insert Size 891 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001270888.1
RefSeq Size 2035 bp
RefSeq ORF 891 bp
Locus ID 1468
UniProt ID Q9UBX3
MW 32.1 kDa
Gene Summary This gene encodes a member of a family of proteins that translocate small metabolites across the mitochondrial membrane. The encoded protein exchanges dicarboxylates, such as malate and succinate, for phosphate, sulfate, and other small molecules, thereby providing substrates for metabolic processes including the Krebs cycle and fatty acid synthesis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2012]
Transcript Variant: This variant (1) represents the longest transcript and encodes isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

其它Mitochondrial dicarboxylate carrier产品

Customer Reviews 
Loading...