Nurim (NRM) (NM_001270710) Human Untagged Clone

CAT#: SC330870

NRM (untagged) - Homo sapiens nurim (nuclear envelope membrane protein) (NRM), transcript variant 5



  "NM_001270710" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-NRM Antibody
    • 100 ul

CNY 5,250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms NRM29
Vector pCMV6-Entry
Sequence Data
>SC330870 representing NM_001270710.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCCCCTGCACTGCTCCTGATCCCTGCTGCCCTCGCCTCTTTCATCCTGGCCTTTGGCACCGGAGTG
GAGTTCGTGCGCTTTACCTCCCTTCGGCCACTTCTTGGAGGGATCCCGGAGTCTGGTGGTCCGGGTATA
CTACCATGTGCTGGGGCTGGGCGAGCCTCTGGCCCTGAAGTCTCCCCGGGCTCTCAGACTCTTCTCCCA
CCTGCGCCACCCAGTGTGTGTGGAGCTGCTGACAGTGCTGTGGGTGGTGCCTACCCTGGGCACGGACCG
TCTCCTCCTTGCTTTCCTCCTTACCCTCTACCTGGGCCTGGCTCACGGGCTTGA

Restriction Sites SgfI-MluI     
ACCN NM_001270710
Insert Size 330 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001270710.1
RefSeq Size 1196 bp
RefSeq ORF 330 bp
Locus ID 11270
UniProt ID Q8IXM6
Protein Families Transmembrane
MW 10.5 kDa
Gene Summary The protein encoded by this gene contains transmembrane domains and resides within the inner nuclear membrane, where it is tightly associated with the nucleus. This protein shares homology with isoprenylcysteine carboxymethyltransferase enzymes. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]
Transcript Variant: This variant (5) lacks two alternate in-frame exons in the coding region compared to variant 1. The resulting isoform (5) has a distinct C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...