RPL18 (NM_001270490) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	DBA18; L18
Vector	pCMV6-Entry
Sequence Data	Fully Sequenced ORF (showhide) >SC330851 representing NM_001270490. Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGTTATACAGGTTTCTGGCCAGAAGAACCAACTCCACATTCAACCAGGTTGTGTTGAAGAGGTTGTTT ATGAGTCGCACCAACCGGCCGCCTCTGTCCCTTTCCCGGATGATCCGGAAGATGAAGCTTCCTGGCCGG GAAAACAAGACGGCCGTGGTTGTGGGGACCATAACTGATGATGTGCGGGTTCAGGAGGTACCCAAACTG AAGGTATGTGCACTGCGCGTGACCAGCCGGGCCCGCAGCCGCATCCTCAGGGCAGGGGGCAAGATCCTC ACTTTCGACCAGCTGGCCCTGGACTCCCCTAAGGGCTGTGGCACTGTCCTGCTCTCCGGTCCTCGCAAG GGCCGAGAGGTGTACCGGCATTTCGGCAAGGCCCCAGGAACCCCGCACAGCCACACCAAACCCTACGTC CGCTCCAAGGGCCGGAAGTTCGAGCGTGCCAGAGGCCGACGGGCCAGCCGAGGCTACAAAAACTAA
Restriction Sites	SgfI-MluI
ACCN	NM_001270490
Insert Size	480 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note	Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq	NM_001270490.1
RefSeq Size	806 bp
RefSeq ORF	480 bp
Locus ID	6141
UniProt ID	Q07020
Protein Pathways	Ribosome
MW	18.1 kDa
Gene Summary	Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a member of the L18E family of ribosomal proteins that is a component of the 60S subunit. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012] Transcript Variant: This variant (2) lacks an exon in the 5' coding region, but maintains the reading frame, compared to variant 1. The encoded isoform (2) has a shorter N-terminus, compared to isoform 1.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.