ST3GAL3 (NM_001270464) Human Untagged Clone

CAT#: SC330844

ST3GAL3 (untagged) - Homo sapiens ST3 beta-galactoside alpha-2,3-sialyltransferase 3 (ST3GAL3), transcript variant 16



  "NM_001270464" in other vectors (2)

CN¥ 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
ST3GAL3 Rabbit polyclonal Antibody
    • 100 ul

CN¥ 1,999.00
CN¥ 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DEE15; EIEE15; MRT12; SIAT6; ST3GALII; ST3Gal III; ST3GalIII; ST3N
Vector pCMV6-Entry
Sequence Data
>SC330844 representing NM_001270464.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGGACTCTTGGTATTTGTGCGCAATCTGCTGCTAGCCCTCTGCCTCTTTCTGGTACTGGGATTTTTG
TATTATTCTGCGTGGAAGCTACACTTACTCCAGTGGGAGGAGGACTCCAAGTATGATCGGTTGGGCTTC
CTCCTGAATCTGGACTCTAAACTGCCTGCTGAATTAGCCACCAAGTACGCAAACTTTTCAGAGGGAGCT
TGCAAGCCTGGCTATGCTTCAGCCTTGATGACGGCCATCTTCCCCCGGTTCTCCAAGCCAGCACCCATG
TTCCTGGATGACTCCTTTCGCAAGTGGGCTAGAATCCGGGAGTTCGTGCCGCCTTTTGGGATCAAAGGT
CAAGACAATCTGATCAAAGCCATCTTGTCAGTCACCAAAGAGTACCGCCTGACCCCTGCCTTGGACAGC
CTCCGCTGCCGCCGCTGCATCATCGTGGGCAATGGAGGCGTTCTTGCCAACAAGTCTCTGGGGTCACGA
ATTGACGACTATGACATTGTGGTGAGTCCTGGACGCACAATATCCAGCGAGAGAAAGAGTTTCTGCGGA
AGCTGGTGA

Restriction Sites SgfI-MluI     
ACCN NM_001270464
Insert Size 561 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001270464.1
RefSeq Size 1765 bp
RefSeq ORF 561 bp
Locus ID 6487
UniProt ID Q11203
Protein Families Secreted Protein, Transmembrane
Protein Pathways Glycosphingolipid biosynthesis - lacto and neolacto series, Keratan sulfate biosynthesis, Metabolic pathways
MW 21 kDa
Gene Summary The protein encoded by this gene is a type II membrane protein that catalyzes the transfer of sialic acid from CMP-sialic acid to galactose-containing substrates. The encoded protein is normally found in the Golgi apparatus but can be proteolytically processed to a soluble form. This protein is a member of glycosyltransferase family 29. Mutations in this gene have been associated with a form of autosomal recessive nonsymdromic cognitive disability as well as infantile epileptic encephalopathy. Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2017]
Transcript Variant: This variant (16) uses an alternate in-frame splice site in the 5' coding region and lacks five alternate in-frame exon compared to variant 1. The resulting isoform (p, also called C5) is shorter compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...