ST3GAL3 (NM_001270464) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	DEE15; EIEE15; MRT12; SIAT6; ST3GALII; ST3Gal III; ST3GalIII; ST3N
Vector	pCMV6-Entry
Sequence Data	Fully Sequenced ORF (showhide) >SC330844 representing NM_001270464. Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGGACTCTTGGTATTTGTGCGCAATCTGCTGCTAGCCCTCTGCCTCTTTCTGGTACTGGGATTTTTG TATTATTCTGCGTGGAAGCTACACTTACTCCAGTGGGAGGAGGACTCCAAGTATGATCGGTTGGGCTTC CTCCTGAATCTGGACTCTAAACTGCCTGCTGAATTAGCCACCAAGTACGCAAACTTTTCAGAGGGAGCT TGCAAGCCTGGCTATGCTTCAGCCTTGATGACGGCCATCTTCCCCCGGTTCTCCAAGCCAGCACCCATG TTCCTGGATGACTCCTTTCGCAAGTGGGCTAGAATCCGGGAGTTCGTGCCGCCTTTTGGGATCAAAGGT CAAGACAATCTGATCAAAGCCATCTTGTCAGTCACCAAAGAGTACCGCCTGACCCCTGCCTTGGACAGC CTCCGCTGCCGCCGCTGCATCATCGTGGGCAATGGAGGCGTTCTTGCCAACAAGTCTCTGGGGTCACGA ATTGACGACTATGACATTGTGGTGAGTCCTGGACGCACAATATCCAGCGAGAGAAAGAGTTTCTGCGGA AGCTGGTGA
Restriction Sites	SgfI-MluI
ACCN	NM_001270464
Insert Size	561 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note	Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq	NM_001270464.1
RefSeq Size	1765 bp
RefSeq ORF	561 bp
Locus ID	6487
UniProt ID	Q11203
Protein Families	Secreted Protein, Transmembrane
Protein Pathways	Glycosphingolipid biosynthesis - lacto and neolacto series, Keratan sulfate biosynthesis, Metabolic pathways
MW	21 kDa
Gene Summary	The protein encoded by this gene is a type II membrane protein that catalyzes the transfer of sialic acid from CMP-sialic acid to galactose-containing substrates. The encoded protein is normally found in the Golgi apparatus but can be proteolytically processed to a soluble form. This protein is a member of glycosyltransferase family 29. Mutations in this gene have been associated with a form of autosomal recessive nonsymdromic cognitive disability as well as infantile epileptic encephalopathy. Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2017] Transcript Variant: This variant (16) uses an alternate in-frame splice site in the 5' coding region and lacks five alternate in-frame exon compared to variant 1. The resulting isoform (p, also called C5) is shorter compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.