KCNE1 (NM_001270405) Human Untagged Clone

CAT#: SC330827

KCNE1 (untagged) - Homo sapiens potassium voltage-gated channel, Isk-related family, member 1 (KCNE1), transcript variant 8



  "NM_001270405" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


KCNE1 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ISK; JLNS; JLNS2; LQT2/5; LQT5; MinK
Vector pCMV6-Entry
Sequence Data
>SC330827 representing NM_001270405.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGATCCTGTCTAACACCACAGCGGTGACGCCCTTTCTGACCAAGCTGTGGCAGGAGACAGTTCAGCAG
GGTGGCAACATGTCGGGCCTGGCCCGCAGGTCCCCCCGCAGCAGTGACGGCAAGCTGGAGGCCCTCTAC
GTCCTCATGGTACTGGGATTCTTCGGCTTCTTCACCCTGGGCATCATGCTGAGCTACATCCGCTCCAAG
AAGCTGGAGCACTCGAACGACCCATTCAACGTCTACATCGAGTCCGATGCCTGGCAAGAGAAGGACAAG
GCCTATGTCCAGGCCCGGGTCCTGGAGAGCTACAGGTCGTGCTATGTCGTTGAAAACCATCTGGCCATA
GAACAACCCAACACACACCTTCCTGAGACGAAGCCTTCCCCATGA

Restriction Sites SgfI-MluI     
ACCN NM_001270405
Insert Size 390 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001270405.1
RefSeq Size 3151 bp
RefSeq ORF 390 bp
Locus ID 3753
UniProt ID P15382
Protein Families Druggable Genome, Ion Channels: Other, Transmembrane
MW 14.7 kDa
Gene Summary The product of this gene belongs to the potassium channel KCNE family. Potassium ion channels are essential to many cellular functions and show a high degree of diversity, varying in their electrophysiologic and pharmacologic properties. This gene encodes a transmembrane protein known to associate with the product of the KVLQT1 gene to form the delayed rectifier potassium channel. Mutation in this gene are associated with both Jervell and Lange-Nielsen and Romano-Ward forms of long-QT syndrome. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (8) differs in the 5' UTR, compared to variant 2. All variants encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...