hHR23A (RAD23A) (NM_001270362) Human Untagged Clone

CAT#: SC330807

RAD23A (untagged) - Homo sapiens RAD23 homolog A (S. cerevisiae) (RAD23A), transcript variant 2



  "NM_001270362" in other vectors (2)

CNY 3,520.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit monoclonal antibody against RAD23A(clone EPR4818)
    • 100 ul

CNY 6,325.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HHR23A; HR23A
Vector pCMV6-Entry
Sequence Data
>SC330807 representing NM_001270362.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCCGTCACCATCACGCTCAAAACGCTGCAGCAGCAGACCTTCAAGATCCGCATGGAGCCTGACGAG
ACGGTGAAGGTGCTAAAGGAGAAGATAGAAGCTGAGAAGGGTCGTGATGCCTTCCCCGTGGCTGGACAG
AAACTCATCTATGCCGGCAAGATCTTGAGTGACGATGTCCCTATCAGGGACTATCGCATCGATGAGAAG
AACTTTGTGGTCGTCATGGTGACCAAGACCAAAGCCGGCCAGGGTACCTCAGCACCCCCAGAGGCCTCA
CCCACAGCTGCCCCAGAGTCCTCTACATCCTTCCCGCCTGCCCCCACCTCAGGCATGTCCCATCCCCCA
CCTGCCGCCAGAGAGGACAAGAGCCCATCAGAGGAATCCGCCCCCACGACGTCCCCAGAGTCTGTGTCA
GGCTCTGTTCCCTCTTCAGGTAGCAGCGGGCGAGAGGAAGACGCGGCCTCCACGCTAGTGACGGGCTCT
GAGTATGAGACGATGCTGACGGAGATCATGTCCATGGGCTATGAGCGAGAGCGGGTCGTGGCCGCCCTG
AGAGCCAGCTACAACAACCCCCACCGAGCCGTGGAGTATCTGCTCACGGGAATTCCTGGGAGCCCCGAG
CCGGAACACGGTTCTGTCCAGGAGAGCCAGGTATCGGAGCAGCCGGCCACGGAAGCAGGAGAGAACCCC
CTGGAGTTCCTGCGGGACCAGCCCCAGTTCCAGAACATGCGGCAGGTGATTCAGCAGAACCCTGCGCTG
CTGCCCGCCCTGCTCCAGCAGCTGGGCCAGGAGAACCCTCAGCTTTTACAGCAAATCAGCCGGCACCAG
GAGCAGTTCATCCAGATGCTGAACGAGCCCCCTGGGGAGCTGGCGGACATCTCAGATGTGGAGGGGGAG
GTGGGCGCCATAGGAGAGGAGGCCCCGCAGATGAACTACATCCAGGTGACGCCGCAGGAGAAAGAAGCT
ATAGAGAGGTTGAAGGCCCTGGGCTTCCCAGAGAGCCTGGTCATCCAGGCCTATTTCGCGTGTGAAAAA
AATGAGAACTTGGCTGCCAACTTCCTCCTGAGTCAGAACTTTGATGACGAGTGA

Restriction Sites SgfI-MluI     
ACCN NM_001270362
Insert Size 1089 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001270362.1
RefSeq Size 1818 bp
RefSeq ORF 1089 bp
Locus ID 5886
UniProt ID P54725
Protein Families Druggable Genome
Protein Pathways Nucleotide excision repair
MW 39.5 kDa
Gene Summary The protein encoded by this gene is one of two human homologs of Saccharomyces cerevisiae Rad23, a protein involved in nucleotide excision repair. Proteins in this family have a modular domain structure consisting of an ubiquitin-like domain (UbL), ubiquitin-associated domain 1 (UbA1), XPC-binding domain and UbA2. The protein encoded by this gene plays an important role in nucleotide excision repair and also in delivery of polyubiquitinated proteins to the proteasome. Alternative splicing results in multiple transcript variants encoding multiple isoforms. [provided by RefSeq, Jun 2012]
Transcript Variant: This variant (2) uses an alternate in-frame splice site in the coding region, compared to variant 1. This results in a shorter protein (isoform 2), compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...