PSME3 (NM_001267045) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	HEL-S-283; Ki; PA28-gamma; PA28G; PA28gamma; REG-GAMMA
Vector	pCMV6-Entry
Sequence Data	Fully Sequenced ORF (showhide) >SC330746 representing NM_001267045. Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGAAAAATGGATCCTCAAAAAAATAAAGTATTTGCAGTCTGGGGGCCTCTCAGCTTCTTATTACAGT TACAAGGTTGATTCTTTCAGGGAGCGGATCACAAGTGAGGCAGAAGACTTGGTGGCAAATTTTTTCCCA AAGAAGTTATTAGAACTTGATAGTTTTCTGAAGGAACCAATCTTAAACATCCATGACCTAACTCAGATC CACTCTGACATGAATCTCCCAGTCCCTGACCCCATTCTTCTCACCAATAGCCATGATGGACTGGATGGT CCCACTTATAAGAAGCGAAGGTTGGATGAGTGTGAAGAAGCCTTCCAAGGAACCAAGGTGTTTGTGATG CCCAATGGGATGCTGAAAAGCAACCAGCAGCTGGTGGACATTATTGAGAAAGTGAAACCTGAGATCCGG CTGTTGATTGAGAAATGTAACACGGTCAAAATGTGGGTACAGCTCCTGATTCCCAGGATAGAAGATGGA AACAACTTTGGGGTGTCCATTCAGGAGGAAACAGTTGCAGAGCTAAGAACTGTTGAGAGTGAAGCTGCA TCTTATCTGGACCAGATTTCTAGATATTATATTACAAGAGCCAAATTGGTTTCTAAAATAGCTAAATAT CCCCATGTGGAGGACTATCGCCGCACCGTGACAGAGATTGATGAGAAAGAATATATCAGCCTTCGGCTC ATCATATCAGAGCTGAGGAATCAATATGTCACTCTACATGACATGATCCTGAAAAATATCGAGAAGATC AAACGGCCCCGGAGCAGCAATGCAGAGACTCTGTACTGA
Restriction Sites	SgfI-MluI
ACCN	NM_001267045
Insert Size	798 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq	NM_001267045.1
RefSeq Size	3782 bp
RefSeq ORF	798 bp
Locus ID	10197
Protein Families	Stem cell - Pluripotency
Protein Pathways	Antigen processing and presentation, Proteasome
MW	30.9 kDa
Gene Summary	The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. The immunoproteasome contains an alternate regulator, referred to as the 11S regulator or PA28, that replaces the 19S regulator. Three subunits (alpha, beta and gamma) of the 11S regulator have been identified. This gene encodes the gamma subunit of the 11S regulator. Six gamma subunits combine to form a homohexameric ring. Alternate splicing results in multiple transcript variants. [provided by RefSeq, May 2012] Transcript Variant: This variant (3) differs in the 5' UTR and 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (3) has a distinct N-terminus and is longer than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.