SPT3 (SUPT3H) (NM_001261823) Human Untagged Clone

CAT#: SC330724

SUPT3H (untagged) - Homo sapiens suppressor of Ty 3 homolog (S. cerevisiae) (SUPT3H), transcript variant 3



  "NM_001261823" in other vectors (2)

CN¥ 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
SUPT3H mouse monoclonal antibody, clone OTI1A5 (formerly 1A5)
    • 100 ul

CN¥ 1,999.00
CN¥ 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms SPT3; SPT3L
Vector pCMV6-Entry
Sequence Data
>SC330724 representing NM_001261823.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTTTGAAGATGACGAAATTGATGAAGTTAAACAAGAAAGAATGGAGAGAGCAGAAAGACAAACTCGA
ATTATGGATTCAGCTCAATATGCAGAATTCTGTGAAAGTCGACAATTAAGTTTCTCCAAAAAAGCTTCC
AAATTTCGAGACTGGTTGGACTGCAGCAGTATGGAGATAAAACCCAATGTTGTCGCAATGGAAATCTTA
GCATATTTAGCGTATGAAACTGTGGCACAGTTAGTGGATCTGGCTCTTCTTGTGAGGCAAGACATGGTA
ACCAAGGCAGGGGACCCCTTCAGCCATGCCATTTCTGCAACCTTCATTCAGTATCACAACTCTGCTGAG
AGCACTGCAGCCTGTGGTGTTGAGGCTCACAGCGATGCCATCCAGCCCTGCCACATCAGAGAGGCCATT
CGACGCTACAGCCACAGGATTGGCCCACTTTCCCCATTCACAAATGCCTACCGCAGGAATGGGATGGCT
TTTCTAGCCTGCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001261823
Insert Size 498 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001261823.1
RefSeq Size 4233 bp
RefSeq ORF 498 bp
Locus ID 8464
Protein Families Stem cell - Pluripotency, Transcription Factors
MW 18.8 kDa
Gene Summary Probable transcriptional activator.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) encodes isoform 3. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...