EXTL2 (NM_001261440) Human Untagged Clone

CAT#: SC330710

EXTL2 (untagged) - Homo sapiens exostosin-like glycosyltransferase 2 (EXTL2), transcript variant 3



  "NM_001261440" in other vectors (2)

CNY 3,230.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


EXTL2 Antibody - C-terminal region
    • 50 ug

CNY 4,628.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms EXTR2
Vector pCMV6-Entry
Sequence Data
>SC330710 representing NM_001261440.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAGGTGTTGCCACATCTGCAAACTTCCTGGGAGAGTAATGGGGATTCGAGTGCTTCGATTATCTTTG
GTGGTCATCCTCGTATTATTACTGGTAGCTGGTGCTTTGACTGCCTTACTTCCCAGTGTTAAAGAAGAC
AAGATGCTCATGTTGCGTAGGGAAATAAAATCCCAGGGCAAGTCCACCATGGACTCCTTTACTCTCATA
ATGCAGACGTACAACAGAACAGATCTCTTATTGAAACTTTTAAATCATTATCAGGCTGTACCAAATCTG
CACAAAGTGATTGTGGTATGGAACAATATTGGAGAGAAGGCACCAGATGAATTATGGAATTCTCTAGGG
CCCCACCCTATCCCTGTGATCTTCAAACAACAGACAGCAAACAGGATGAGAAATCGACTCCAGGTCTTT
CCTGAACTGGAAACCAATGTGTTGATGGTAGATGATGACACACTCATCAGCACCCCAGACCTTGTTTTT
GCTTTCTCAGTTTGGCAGCAATTTCCTGATCAAATTGTAGGATTTGTTCCTAGAAAGCACGTCTCTACT
TCATCAGGTATCTACAGTTATGGAAGTTTTGAAATGCAAGCACCAGGGTCTGGAAATGGTGACCAGTAC
TCTATGGTGCTGATTGGAGCCTCATTCTTCAATAGCAAATATCTTGAATTATTTCAGAGGCAACCTGCA
GCTGTCCATGCTTTGATAGATGATACTCAAAACTGTGATGATATTGCCATGAATTTTATCATTGCCAAG
CATATTGGCAAGACTTCAGGGATATTTGTGAAGCCTGTAAACATGGACAATTTGGAAAAAGAAACCAAC
AGTGGCTATTCTGGAATGTGGCATCGAGCTGAGCACGCTCTGCAGAGGTCTTATTGTATAAATAAGCTT
GTTAATATCTATGATAGCATGCCCTTAAGATACTCCAACATTATGATTTCCCAGTTTGGTTTTCCATAT
GCCAACTACAAAAGAAAAATATAA

Restriction Sites SgfI-MluI     
ACCN NM_001261440
Insert Size 990 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001261440.1
RefSeq Size 3178 bp
RefSeq ORF 990 bp
Locus ID 2135
Protein Families Transmembrane
Protein Pathways Heparan sulfate biosynthesis
MW 37.4 kDa
Gene Summary Glycosyltransferase required for the biosynthesis of heparan-sulfate and responsible for the alternating addition of beta-1-4-linked glucuronic acid (GlcA) and alpha-1-4-linked N-acetylglucosamine (GlcNAc) units to nascent heparan sulfate chains.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) uses an alternate splice site in the 5' UTR and an alternate splice site in the coding region, but maintains the reading frame, compared to variant 1. The encoded isoform (2) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...