PAX6 (NM_001258465) Human Untagged Clone

CAT#: SC330689

PAX6 (untagged) - Homo sapiens paired box 6 (PAX6), transcript variant 7



  "NM_001258465" in other vectors (2)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
PAX6 Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

热销推荐


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AN; AN1; AN2; ASGD5; D11S812E; FVH1; MGDA; WAGR
Vector pCMV6-Entry
Sequence Data
>SC330689 representing NM_001258465.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCAGAACAGTCACAGCGGAGTGAATCAGCTCGGTGGTGTCTTTGTCAACGGGCGGCCACTGCCGGAC
TCCACCCGGCAGAAGATTGTAGAGCTAGCTCACAGCGGGGCCCGGCCGTGCGACATTTCCCGAATTCTG
CAGGTGTCCAACGGATGTGTGAGTAAAATTCTGGGCAGGTATTACGAGACTGGCTCCATCAGACCCAGG
GCAATCGGTGGTAGTAAACCGAGAGTAGCGACTCCAGAAGTTGTAAGCAAAATAGCCCAGTATAAGCGG
GAGTGCCCGTCCATCTTTGCTTGGGAAATCCGAGACAGATTACTGTCCGAGGGGGTCTGTACCAACGAT
AACATACCAAGCGTGTCATCAATAAACAGAGTTCTTCGCAACCTGGCTAGCGAAAAGCAACAGATGGGC
GCAGACGGCATGTATGATAAACTAAGGATGTTGAACGGGCAGACCGGAAGCTGGGGCACCCGCCCTGGT
TGGTATCCGGGGACTTCGGTGCCAGGGCAACCTACGCAAGATGGCTGCCAGCAACAGGAAGGAGGGGGA
GAGAATACCAACTCCATCAGTTCCAACGGAGAAGATTCAGATGAGGCTCAAATGCGACTTCAGCTGAAG
CGGAAGCTGCAAAGAAATAGAACATCCTTTACCCAAGAGCAAATTGAGGCCCTGGAGAAAGAGTTTGAG
AGAACCCATTATCCAGATGTGTTTGCCCGAGAAAGACTAGCAGCCAAAATAGATCTACCTGAAGCAAGA
ATACAGGTATGGTTTTCTAATCGAAGGGCCAAATGGAGAAGAGAAGAAAAACTGAGGAATCAGAGAAGA
CAGGCCAGCAACACACCTAGTCATATTCCTATCAGCAGTAGTTTCAGCACCAGTGTCTACCAACCAATT
CCACAACCCACCACACCGGTTTCCTCCTTCACATCTGGCTCCATGTTGGGCCGAACAGACACAGCCCTC
ACAAACACCTACAGCGCTCTGCCGCCTATGCCCAGCTTCACCATGGCAAATAACCTGCCTATGCAACCC
CCAGTCCCCAGCCAGACCTCCTCATACTCCTGCATGCTGCCCACCAGCCCTTCGGTGAATGGGCGGAGT
TATGATACCTACACCCCCCCACATATGCAGACACACATGAACAGTCAGCCAATGGGCACCTCGGGCACC
ACTTCAACAGGACTCATTTCCCCTGGTGTGTCAGTTCCAGTTCAAGTTCCCGGAAGTGAACCTGATATG
TCTCAATACTGGCCAAGATTACAGTAA

Restriction Sites SgfI-MluI     
ACCN NM_001258465
Insert Size 1269 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001258465.1
RefSeq Size 6857 bp
RefSeq ORF 1269 bp
Locus ID 5080
UniProt ID P26367
Protein Families Adult stem cells, Druggable Genome, Embryonic stem cells, Transcription Factors
Protein Pathways Maturity onset diabetes of the young
MW 46.7 kDa
Gene Summary This gene encodes paired box protein Pax-6, one of many human homologs of the Drosophila melanogaster gene prd. In addition to a conserved paired box domain, a hallmark feature of this gene family, the encoded protein also contains a homeobox domain. Both domains are known to bind DNA and function as regulators of gene transcription. Activity of this protein is key in the development of neural tissues, particularly the eye. This gene is regulated by multiple enhancers located up to hundreds of kilobases distant from this locus. Mutations in this gene or in the enhancer regions can cause ocular disorders such as aniridia and Peter's anomaly. Use of alternate promoters and alternative splicing results in multiple transcript variants encoding different isoforms. Interestingly, inclusion of a particular alternate coding exon has been shown to increase the length of the paired box domain and alter its DNA binding specificity. Consequently, isoforms that carry the shorter paired box domain regulate a different set of genes compared to the isoforms carrying the longer paired box domain. [provided by RefSeq, Mar 2019]
Transcript Variant: This variant (7) differs in the 5' UTR compared to variant 1. It initiates from the B (P1) promoter. Variants 1, 3, 6, 7, and 12-16 all encode the same isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...