VILIP3 (HPCAL1) (NM_001258359) Human Untagged Clone

CAT#: SC330675

HPCAL1 (untagged) - Homo sapiens hippocalcin-like 1 (HPCAL1), transcript variant 5



  "NM_001258359" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


HPCAL1 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BDR1; HLP2; VILIP-3
Vector pCMV6-Entry
Sequence Data
>SC330675 representing NM_001258359.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGGCAAACAGAACAGCAAGCTGCGGCCCGAGGTGCTGCAGGACCTGCGGGAGAACACGGAGTTCACC
GACCACGAGCTGCAGGAGTGGTACAAGGGCTTCCTCAAGGACTGCCCCACCGGCCACCTGACCGTGGAC
GAGTTCAAGAAGATCTACGCCAACTTCTTCCCCTACGGCGACGCTTCCAAGTTCGCCGAGCACGTCTTC
CGCACCTTCGACACCAACGGCGACGGCACCATCGACTTCCGGGAGTTCATCATTGCGCTGAGCGTGACC
TCGCGGGGCAAGCTGGAGCAGAAGCTCAAGTGGGCCTTCAGCATGTACGACCTGGACGGCAACGGCTAC
ATCAGCCGCAGCGAGATGCTGGAGATCGTGCAGGCCATCTACAAGATGGTGTCGTCTGTGATGAAGATG
CCGGAGGATGAGTCCACCCCGGAGAAGCGCACAGACAAGATCTTCAGGCAGATGGACACCAACAATGAC
GGCAAACTGTCCTTGGAAGAATTCATCAGAGGTGCCAAGAGCGACCCCTCCATCGTCCGCCTGCTGCAG
TGCGACCCCAGCAGTGCCAGTCAGTTCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001258359
Insert Size 582 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001258359.1
RefSeq Size 1959 bp
RefSeq ORF 582 bp
Locus ID 3241
UniProt ID P37235
MW 22.3 kDa
Gene Summary The protein encoded by this gene is a member of neuron-specific calcium-binding proteins family found in the retina and brain. It is highly similar to human hippocalcin protein and nearly identical to the rat and mouse hippocalcin like-1 proteins. It may be involved in the calcium-dependent regulation of rhodopsin phosphorylation and may be of relevance for neuronal signalling in the central nervous system. Several alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Apr 2012]
Transcript Variant: This variant (5) represents the longest transcript. All five variants encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...