DAP13 (NDUFA12) (NM_001258338) Human Untagged Clone
CAT#: SC330665
NDUFA12 (untagged) - Homo sapiens NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 12 (NDUFA12), transcript variant 2
CNY 2,950.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | B17.2; DAP13; MC1DN23 |
Vector | pCMV6-Entry |
Sequence Data |
>SC330665 representing NM_001258338.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGAGTTAGTGCAGGTCCTGAAACGCGGGCTGCAGCAGATCACCGGCCACGGCGGTCTCCGAGGCTAT CTACGGGTTTTTTTCAGGACAAATGATGCGAAGGTTGGTACATTAGTGGGGGAAGACAAATATGGAAAC AAATACTATGAAGACAACAAGCAATTTTTTGGCATCGTTGGCTTCACAGTATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001258338 |
Insert Size | 192 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001258338.1 |
RefSeq Size | 504 bp |
RefSeq ORF | 192 bp |
Locus ID | 55967 |
UniProt ID | Q9UI09 |
MW | 7.2 kDa |
Gene Summary | This gene encodes a protein which is part of mitochondrial complex 1, part of the oxidative phosphorylation system in mitochondria. Complex 1 transfers electrons to ubiquinone from NADH which establishes a proton gradient for the generation of ATP. Mutations in this gene are associated with Leigh syndrome due to mitochondrial complex 1 deficiency. Pseudogenes of this gene are located on chromosomes 5 and 13. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2012] Transcript Variant: This variant (2) lacks an alternate exon which results in a frameshift and an early stop codon compared to variant 1. The resulting protein (isoform b) is shorter and has a distinct C-terminus compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC231526 | NDUFA12 (Myc-DDK tagged) - Homo sapiens NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 12 (NDUFA12), transcript variant 2 |
CNY 3,990.00 |
|
RG231526 | NDUFA12 (tGFP-tagged) - Homo sapiens NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 12 (NDUFA12), transcript variant 2 |
CNY 4,370.00 |