DAP13 (NDUFA12) (NM_001258338) Human Untagged Clone

CAT#: SC330665

NDUFA12 (untagged) - Homo sapiens NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 12 (NDUFA12), transcript variant 2



  "NM_001258338" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


NDUFA12 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms B17.2; DAP13; MC1DN23
Vector pCMV6-Entry
Sequence Data
>SC330665 representing NM_001258338.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGAGTTAGTGCAGGTCCTGAAACGCGGGCTGCAGCAGATCACCGGCCACGGCGGTCTCCGAGGCTAT
CTACGGGTTTTTTTCAGGACAAATGATGCGAAGGTTGGTACATTAGTGGGGGAAGACAAATATGGAAAC
AAATACTATGAAGACAACAAGCAATTTTTTGGCATCGTTGGCTTCACAGTATGA

Restriction Sites SgfI-MluI     
ACCN NM_001258338
Insert Size 192 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001258338.1
RefSeq Size 504 bp
RefSeq ORF 192 bp
Locus ID 55967
UniProt ID Q9UI09
MW 7.2 kDa
Gene Summary This gene encodes a protein which is part of mitochondrial complex 1, part of the oxidative phosphorylation system in mitochondria. Complex 1 transfers electrons to ubiquinone from NADH which establishes a proton gradient for the generation of ATP. Mutations in this gene are associated with Leigh syndrome due to mitochondrial complex 1 deficiency. Pseudogenes of this gene are located on chromosomes 5 and 13. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2012]
Transcript Variant: This variant (2) lacks an alternate exon which results in a frameshift and an early stop codon compared to variant 1. The resulting protein (isoform b) is shorter and has a distinct C-terminus compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...