VSIG4 (NM_001257403) Human Untagged Clone

CAT#: SC330618

VSIG4 (untagged) - Homo sapiens V-set and immunoglobulin domain containing 4 (VSIG4), transcript variant 5



  "NM_001257403" in other vectors (2)

CNY 3,330.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
VSIG4 Antibody - N-terminal region
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CRIg; Z39IG
Vector pCMV6-Entry
Sequence Data
>SC330618 representing NM_001257403.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGGGATCTTACTGGGCCTGCTACTCCTGGGGCACCTAACAGTGGACACTTATGGCCGTCCCATCCTG
GAAGTGCCAGAGAGTGTAACAGGACCTTGGAAAGGGGATGTGAATCTTCCCTGCACCTATGACCCCCTG
CAAGGCTACACCCAAGTCTTGGTGAAGTGGCTGGTACAACGTGGCTCAGACCCTGTCACCATCTTTCTA
CGTGACTCTTCTGGAGACCATATCCAGCAGGCAAAGTACCAGGGCCGCCTGCATGTGAGCCACAAGGTT
CCAGGAGATGTATCCCTCCAATTGAGCACCCTGGAGATGGATGACCGGAGCCACTACACGTGTGAAGTC
ACCTGGCAGACTCCTGATGGCAACCAAGTCGTGAGAGATAAGATTACTGAGCTCCGTGTCCAGAAACTC
TCTGTCTCCAAGCCCACAGTGACAACTGGCAGCGGTTATGGCTTCACGGTGCCCCAGGGAATGAGGATT
AGCCTTCAATGCCAGGCTCGGGGTTCTCCTCCCATCAGTTATATTTGGTATAAGCAACAGACTAATAAC
CAGGAACCCATCAAAGTAGCAACCCTAAGTACCTTACTCTTCAAGCCTGCGGTGATAGCCGACTCAGGC
TCCTATTTCTGCACTGCCAAGGGCCAGGTTGGCTCTGAGCAGCACAGCGACATTGTGAAGTTTGTGGTC
AAAGACTCCTCAAAGCTACTCAAGACCAAGACTGAGGCACCTACAACCATGACATACCCCTTGAAAGCA
ACATCTACAGTGAAGCAGTCCTGGGACTGGACCACTGACATGGATGGCTACCTTGGAGAGACCAGTGCT
GGGCCAGGAAAGAGCCTGCCTGTCTTTGCCATCATCCTCATCATCTCCTTGTGCTGTATGGTGGTTTTT
ACCATGGCCTATATCATGCTCTGTCGGAAGACATCCCAACAAGAGCATGTCTACGAAGCAGCCAGCCCA
AAGTGTCCGCCTACCAACACTGGAGCCGCTGGGAGTCACTGGCTTTGCCCTGGAATTTGCCAGATGCAT
CTCAAGTAA

Restriction Sites SgfI-MluI     
ACCN NM_001257403
Insert Size 1044 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001257403.1
RefSeq Size 1535 bp
RefSeq ORF 1044 bp
Locus ID 11326
UniProt ID Q9Y279
Protein Families Transmembrane
MW 38.2 kDa
Gene Summary This gene encodes a v-set and immunoglobulin-domain containing protein that is structurally related to the B7 family of immune regulatory proteins. The encoded protein may be a negative regulator of T-cell responses. This protein is also a receptor for the complement component 3 fragments C3b and iC3b. Alternate splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
Transcript Variant: This variant (5) uses an alternate splice junction at the 5' end of a coding exon compared to variant 1. The resulting isoform (5) has a shorter and distinct C-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...