DIS3L2 (NM_001257282) Human Untagged Clone

CAT#: SC330593

DIS3L2 (untagged) - Homo sapiens DIS3 mitotic control homolog (S. cerevisiae)-like 2 (DIS3L2), transcript variant 3



  "NM_001257282" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-MGC42174 Antibody
    • 100 ug

CNY 5,250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms FAM6A; hDIS3L2; PRLMNS
Vector pCMV6-Entry
Sequence Data
>SC330593 representing NM_001257282.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAGCCATCCTGACTACAGAATGAACCTCCGGCCCCTGGGGACCCCCAGAGGTGTGTCTGCTGTGGCT
GGTCCACATGACATTGGTGCTTCGCCAGGTGACAAAAAGTCAAAGAACAGGTCCACACGAGGGAAGAAA
AAGAGCATATTTGAAACTTACATGTCCAAGGAGGATGTTTCAGAAGGCTTGAAGAGAGGAACACTCATC
CAGGGTGTATTGAGAATTAATCCAAAGAAGTTTCATGAAGCCTTCATTCCTTCCCCGGATGGTGATCGA
GACATTTTTATTGATGGGGTTGTTGCTCGTAATAGAGCCTTAAATGGGGATCTGGTGGTCGTGAAACTG
CTTCCCGAGGAGCATTGGAAGGTAGTTAAACCAGAGAGCAATGACAAAGAAACAGAAGCTGCGTATGAA
TCAGATATCCCCGAGGAGCTCTGTGGACACCATCTCCCGCAACAGTCCCTGAAAAGCTATAATGACAGT
CCTGATGTCATTGTAGAGGCTCAGTTTGATGGCAGCGACTCAGAAGATGGACATGGCATCACACAAAAT
GTGCTGGTTGATGGTGTTAAGAAACTCTCAGTTTGTGTTTCTGAGAAAGGAAGAGAGGATGGTGATGCA
CCGGTTACAAAAGATGAGACCACCTGCATTTCACAAGACACAAGAGCTTTATCGGAGAAATCCCTGCAA
AGATCAGCAAAGGTCATTGCCTACAGATTTTCTCCACGTGTCCAAATGGCTTTCACCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001257282
Insert Size 750 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001257282.1
RefSeq Size 1154 bp
RefSeq ORF 750 bp
Locus ID 129563
UniProt ID Q8IYB7
MW 27.5 kDa
Gene Summary The protein encoded by this gene is similar in sequence to 3'/5' exonucleolytic subunits of the RNA exosome. The exosome is a large multimeric ribonucleotide complex responsible for degrading various RNA substrates. Several transcript variants, some protein-coding and some not, have been found for this gene. [provided by RefSeq, Mar 2012]
Transcript Variant: This variant (3) lacks several exons and its transcription extends past a splice site that is used in variant 1, resulting in a novel 3' coding region and 3' UTR compared to variant 1. It encodes isoform 3, which is shorter and has a distinct C-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...