Caspase 1 (CASP1) (NM_001257118) Human Untagged Clone

CAT#: SC330567

CASP1 (untagged) - Homo sapiens caspase 1, apoptosis-related cysteine peptidase (CASP1), transcript variant 6



  "NM_001257118" in other vectors (2)

CNY 3,800.00


货期*
2周

规格
    • 10 ug

Product images

经常一起买 (4)
Mouse Monoclonal Caspase-1 Antibody (14F468)
    • 100 ug

CNY 6,056.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ICE; IL1BC; P45
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_033292 edited
GAGAAAAGCCATGGCCGACAAGGTCCTGAAGGAGAAGAGAAAGCTGTTTATCCGTTCCAT
GGGTGAAGGTACAATAAATGGCTTACTGGATGAATTATTACAGACAAGGGTGCTGAACAA
GGAAGAGATGGAGAAAGTAAAACGTGAAAATGCTACAGTTATGGATAAGACCCGAGCTTT
GATTGACTCCGTTATTCCGAAAGGGGCACAGGCATGCCAAATTTGCATCACATACATTTG
TGAAGAAGACAGTTACCTGGCAGGGACGCTGGGACTCTCAGCAGATCAAACATCTGGAAA
TTACCTTAATATGCAAGACTCTCAAGGAGTACTTTCTTCCTTTCCAGCTCCTCAGGCAGT
GCAGGACAACCCAGCTATGCCCACATCCTCAGGCTCAGAAGGGAATGTCAAGCTTTGCTC
CCTAGAAGAAGCTCAAAGGATATGGAAACAAAAGTCGGCAGAGATTTATCCAATAATGGA
CAAGTCAAGCCGCACACGTCTTGCTCTCATTATCTGCAATGAAGAATTTGACAGTATTCC
TAGAAGAACTGGAGCTGAGGTTGACATCACAGGCATGACAATGCTGCTACAAAATCTGGG
GTACAGCGTAGATGTGAAAAAAAATCTCACTGCTTCGGACATGACTACAGAGCTGGAGGC
ATTTGCACACCGCCCAGAGCACAAGACCTCTGACAGCACGTTCCTGGTGTTCATGTCTCA
TGGTATTCGGGAAGGCATTTGTGGGAAGAAACACTCTGAGCAAGTCCCAGATATACTACA
ACTCAATGCAATCTTTAACATGTTGAATACCAAGAACTGCCCAAGTTTGAAGGACAAACC
GAAGGTGATCATCATCCAGGCCTGCCGTGGTGACAGCCCTGGTGTGGTGTGGTTTAAAGA
TTCAGTAGGAGTTTCTGGAAACCTATCTTTACCAACTACAGAAGAGTTTGAGGATGATGC
TATTAAGAAAGCCCACATAGAGAAGGATTTTATCGCTTTCTGCTCTTCCACACCAGATAA
TGTTTCTTGGAGACATCCCACAATGGGCTCTGTTTTTATTGGAAGACTCATTGAACATAT
GCAAGAATATGCCTGTTCCTGTGATGTGGAGGAAATTTTCCGCAAGGTTCGATTTTCATT
TGAGCAGCCAGATGGTAGAGCGCAGATGCCCACCACTGAAAGAGTGACTTTGACAAGATG
TTTCTACCTCTTCCCAGGACATTAAAATAAGGAAACTGTATGAATGTCTGTGGGCAGGAA
GTGAAGAGATCCTTCTGTAAAGGTTTTTGGAATTATGTCTGCTGAATAATAAACTTTTTT
GAAATAATAAATCTGGTAGAAAAATGAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites SgfI-MluI     
ACCN NM_001257118
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001257118.1, NP_001244047.1
RefSeq Size 2019 bp
RefSeq ORF 2019 bp
Locus ID 834
UniProt ID P29466
Protein Families Druggable Genome, Protease
Protein Pathways Amyotrophic lateral sclerosis (ALS), Cytosolic DNA-sensing pathway, NOD-like receptor signaling pathway
Gene Summary This gene encodes a protein which is a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes which undergo proteolytic processing at conserved aspartic residues to produce 2 subunits, large and small, that dimerize to form the active enzyme. This gene was identified by its ability to proteolytically cleave and activate the inactive precursor of interleukin-1, a cytokine involved in the processes such as inflammation, septic shock, and wound healing. This gene has been shown to induce cell apoptosis and may function in various developmental stages. Studies of a similar gene in mouse suggest a role in the pathogenesis of Huntington disease. Alternative splicing results in transcript variants encoding distinct isoforms. [provided by RefSeq, Mar 2012]
Transcript Variant: This variant (6) differs in the 3' UTR compared to variant alpha. Variant alpha and variant 6 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...