POLD4 (NM_001256870) Human Untagged Clone

CAT#: SC330547

POLD4 (untagged) - Homo sapiens polymerase (DNA-directed), delta 4, accessory subunit (POLD4), transcript variant 2



  "NM_001256870" in other vectors (2)

CN¥ 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
POLD4 Rabbit polyclonal Antibody
    • 100 ul

CN¥ 1,999.00
CN¥ 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms p12; POLDS
Vector pCMV6-Entry
Sequence Data
>SC330547 representing NM_001256870.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGGCCGGAAGCGGCTCATCACTGATTCCTACCCGGTTGTGAAGAGGAGGGAGGGGCCCGCTGGGCAC
AGCAAGGGGGAGCTGGCACCCGAGCTAGGGGAGGAGCCCCAGCCCCGCGACGAGGAGGAAGCGGAGCTG
GAGCTGCTGAGGCAGTTTGACCTGGCCTGGCAGTACGGGCCCTGCACCGTCTCTGGCATCTCTATCCCC
TATGAGGCACCACGTAAGACCTCCTGCCCTTAG

Restriction Sites SgfI-MluI     
ACCN NM_001256870
Insert Size 240 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001256870.1
RefSeq Size 1639 bp
RefSeq ORF 240 bp
Locus ID 57804
UniProt ID Q9HCU8
Protein Pathways Base excision repair, DNA replication, Homologous recombination, Metabolic pathways, Mismatch repair, Nucleotide excision repair, Purine metabolism, Pyrimidine metabolism
MW 8.9 kDa
Gene Summary This gene encodes the smallest subunit of DNA polymerase delta. DNA polymerase delta possesses both polymerase and 3' to 5' exonuclease activity and plays a critical role in DNA replication and repair. The encoded protein enhances the activity of DNA polymerase delta and plays a role in fork repair and stabilization through interactions with the DNA helicase Bloom syndrome protein. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
Transcript Variant: This variant (2) lacks an exon in the coding region, which results in a frameshift, compared to variant 1. The encoded isoform (2) is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...