GLUR3 (GRIA3) (NM_001256743) Human Untagged Clone

CAT#: SC330513

GRIA3 (untagged) - Homo sapiens glutamate receptor, ionotropic, AMPA 3 (GRIA3), transcript variant 3



  "NM_001256743" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Anti-GRIA3 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms GluA3; GLUR-C; GLUR-K3; GLUR3; GLURC; MRX94; MRXSW
Vector pCMV6-Entry
Sequence Data
>SC330513 representing NM_001256743.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCCAGGCAGAAGAAAATGGGGCAAAGCGTGCTCCGGGCGGTCTTCTTTTTAGTCCTGGGGCTTTTG
GGTCATTCTCACGGAGGATTCCCCAACACCATCAGCATAGGTGGACTTTTCATGAGAAACACAGTGCAG
GAGCACAGCGCTTTCCGCTTTGCCGTGCAGTTATACAACACCAACCAGAACACCACCGAGAAGCCCTTC
CATTTGAATTACCACGTAGATCACTTGGATTCCTCCAATAGTTTTTCCGTGACAAATGCTTGTCCTGCT
GAAAGGGACTACCTGCCTTGGCCAGGAAGCATCAGGGAAAACAATTGGACAGCTCTGCCGTGCTGCAAA
GATCATGGGCTGCTGCACCTAAAATGTTCACCAGGTGGGGCCCGCCAAAACTGGGCCTATTGTATCTGG
GGCGTTACAGGTGAACTGTAA

Restriction Sites SgfI-MluI     
ACCN NM_001256743
Insert Size 435 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001256743.1
RefSeq Size 1067 bp
RefSeq ORF 435 bp
Locus ID 2892
Protein Families Druggable Genome, Ion Channels: Glutamate Receptors, Transmembrane
Protein Pathways Long-term depression, Neuroactive ligand-receptor interaction
MW 16.1 kDa
Gene Summary Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. These receptors are heteromeric protein complexes composed of multiple subunits, arranged to form ligand-gated ion channels. The classification of glutamate receptors is based on their activation by different pharmacologic agonists. The subunit encoded by this gene belongs to a family of AMPA (alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate)-sensitive glutamate receptors, and is subject to RNA editing (AGA->GGA; R->G). Alternative splicing at this locus results in different isoforms, which may vary in their signal transduction properties. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (3) lacks several exons and includes alternate 3' exons compared to variant 1. It encodes isoform 3, which is shorter and has a distinct C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...