RPL10 (NM_001256577) Human Untagged Clone

CAT#: SC330460

RPL10 (untagged) - Homo sapiens ribosomal protein L10 (RPL10), transcript variant 2



  "NM_001256577" in other vectors (2)

CN¥ 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
RPL10 mouse monoclonal antibody, clone OTI6B11 (formerly 6B11)
    • 100 ul

CN¥ 1,999.00
CN¥ 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AUTSX5; DXS648; DXS648E; L10; MRXS35; NOV; QM
Vector pCMV6-Entry
Sequence Data
>SC330460 representing NM_001256577.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGGCCGCCGCCCCGCCCGTTGTTACCGGTATTGTAAGAACAAGCCGTACCCAAAGTCTCGCTTCTGC
CGAGGTGTCCCTGATGCCAAGATTCGCATTTTTGACCTGGGGCGGAAAAAGGCAAAAGTGGATGAGTTT
CCGCTTTGTGGCCACATGGTGTCAGATGAATATGAGCAGCTGTCCTCTGAAGCCCTGGAGGCTGCCCGA
ATTTGTGCCAATAAGTACATGGTAAAAAGTTGTGGCAAAGATGGCTTCCATATCCGGGTGCGGCTCCAC
CCCTTCCACGTCATCCGCATCAACAAGATGTTGTCCTGTGCTGGGGCTGACAGATCCACATCTCAAAGA
AGTGGGGCTTCACCAAGTTCAATGCTGATGAATTTGAAGACATGGTGGCTGAAAAGCGGCTCATCCCAG
ATGGCTGTGGGGTCAAGTACATCCCCAATCGTGGCCCTCTGGACAAGTGGCGGGCCCTGCACTCATGAG
GGCTTCCAATGTGCTGCCCCCCTCTTAATACTCACCAATAAATTCTACTTCCTGTCCACCTATGTCTTT
GTATCTACATTCTTGACGGGGAAGGAACTTCCTCTGGGAACCTTTGGGTCATTGCCCTTTCACTTCAGA
AACAGGTTGACAACTCAGCCCTGCTCATGA

Restriction Sites SgfI-MluI     
ACCN NM_001256577
Insert Size 651 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001256577.1
RefSeq Size 2172 bp
RefSeq ORF 651 bp
Locus ID 6134
UniProt ID P27635
Protein Families Druggable Genome
Protein Pathways Ribosome
MW 24.2 kDa
Gene Summary This gene encodes a ribosomal protein that is a component of the 60S ribosome subunit. The related protein in chicken can bind to c-Jun and can repress c-Jun-mediated transcriptional activation. Some studies have detected an association between variation in this gene and autism spectrum disorders, though others do not detect this relationship. There are multiple pseudogenes of this gene dispersed throughout the genome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
Transcript Variant: This variant (2) lacks an alternate exon in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (b) has a distinct, longer C-terminus than isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...