SSBP1 (NM_001256511) Human Untagged Clone

CAT#: SC330442

SSBP1 (untagged) - Homo sapiens single-stranded DNA binding protein 1, mitochondrial (SSBP1), transcript variant 2



  "NM_001256511" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-SSBP1 Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms Mt-SSB; mtSSB; SOSS-B1; SSBP
Vector pCMV6-Entry
Sequence Data
>SC330442 representing NM_001256511.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTTTCGAAGACCTGTATTACAGGTACTTCGTCAGTTTGTAAGACATGAGTCCGAAACAACTACCAGT
TTGGTTCTTGAAAGATCCCTGAATCGTGTGCACTTACTTGGGCGAGTGGGTCAGGACCCTGTCTTGAGA
CAGGTGGAAGGAAAAAATCCAGTCACAATATTTTCTCTAGCAACTAATGAGATGTGGCGATCAGGGGAT
AGTGAAGTTTACCAACTGGGTGATGTCAGTCAAAAGACAACATGGCACAGAATATCAGTATTCCGGCCA
GGCCTCAGAGACGTGGCATATCAATATGTGAAAAAGGGGTCTCGAATTTATTTGGAAGGGAAAATAGAC
TATGGTGAATACATGGATAAAAATAATGTGAGGCGACAAGCAACAACAATCATAGCTGATAATATTATA
TTTCTGAGTGACCAGACGAAAGAGAAGGAGTAG

Restriction Sites SgfI-MluI     
ACCN NM_001256511
Insert Size 447 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001256511.1
RefSeq Size 897 bp
RefSeq ORF 447 bp
Locus ID 6742
UniProt ID Q04837
Protein Families Druggable Genome
Protein Pathways DNA replication, Homologous recombination, Mismatch repair
MW 17.3 kDa
Gene Summary SSBP1 is a housekeeping gene involved in mitochondrial biogenesis (Tiranti et al., 1995 [PubMed 7789991]). It is also a subunit of a single-stranded DNA (ssDNA)-binding complex involved in the maintenance of genome stability (Huang et al., 2009) [PubMed 19683501].[supplied by OMIM, Feb 2010]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 through 5 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...